Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt
Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt
... al. Binding of human immunoagents to ErbB2 FEBS Journal 275 (2008) 4967–4979 ª 2008 The Authors Journal compilation ª 2008 FEBS 4979 Differential binding of human immunoagents and Herceptin to the ... (%)Control Herceptin Herceptin + ECDERB-hcAbERB-hcAb + ECD26Fig. 2. Effects of soluble ErbB2- ECD on the binding and cytotoxic-ity of ERB-hcAb and Herceptin. Binding curves of ERB-hcAb (A) and Herceptin ... waspurchased from GE Healthcare. To investigate the binding properties of Herceptin and ERB-hcAb to the soluble ECD of the ErbB2 receptor, acapture method was chosen. Herceptin and ERB-hcAbwere captured...
- 13
- 367
- 0
Báo cáo khoa học: Differential binding of factor XII and activated factor XII to soluble and immobilized fibronectin – localization of the Hep-1/Fib-1 binding site for activated factor XII pdf
... sites of importancefor fibril generation and elongation [28–30]. The high-affinity binding of FXIIa to the ECM witha KD of 12.8 nm [5] and the binding of FXIIa to the immobilized FN with a KD of ... [18]. The lack of inhibition of FXIIa binding to immobilized FN by the surface-bind-ing peptide strengthens the statement that FN is the target for the binding of FXIIa to the ECM, as this binding ... by the peptide [5].Thus, the affinities for FXIIa binding to ECM and to immobilized FN were the same, and neither one of the binding events could be inhibited by the surface- binding peptide of...
- 12
- 456
- 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... addi-tion to the Mxi1-WR isoform, other Mxi1 protein iso-forms exist both in mouse and man [12–14]. Many of these isoforms appear to arise from alternative exon 1 (and promoter) usage within the mxi1 ... lacks the SID, and shown to give rise to proteins of the expected size expressed at similar levels (Fig. 1A). Each of these constructs (or empty vector) was introducedalong with Myc and Ras into ... 1B). Together, these findings suggested that the differential effects of Mxi1-SRa and Mxi1-SRb in the REF assay likely relate to variables aside from expres-sion levels.As another gauge of suppression...
- 11
- 586
- 0
Báo cáo khoa học: Biochemical characterization of human umbilical vein endothelial cell membrane bound acetylcholinesterase ppt
... isolation and solubilization of the mem-branes of HUVEC process. The arrows indicate (a) the percentage of loss between the beginning of the isolation process and the end of the cell lyses; (b) the ... antibodies of FLT-1 (C-17) and KDR, the two receptors of the vascular endo-thelial growth factors (VEGFs; also termed VEGF-R1 and VEGF-R2, respectively). The results confirm thatthere is enrichment of ... well by othercellular types in various organisms. Altogether, thesestudies led to the introduction of the concepts of ‘non-neuronal ACh’ and ‘non-neuronal cholinergic system’ to describe the activity...
- 11
- 365
- 0
Báo cáo khoa học: Differential expression of endogenous sialidases of human monocytes during cellular differentiation into macrophages potx
... attributed to the activity of Neu1 sialidase, some of which was translocated fromlysosomes to the cell surface [7,19]. The role of the other forms of sialidase in the activation of these cellshas ... 1C,antibodies to human cathepsin A were used to coim-munoprecipitate Neu1 from the cell lysate prior to evaluating sialidase activity. The anti-cathepsin A Igsimmunoprecipitated most of the b-galactosidase(GAL) ... sialylation sites, and thus, their binding may notreflect the global sialylation state of the cell. Furtherstudies will define whether there is a global hyposialy-lation of the cell surface during...
- 12
- 322
- 0
Báo cáo khoa học: Catalytic activation of human glucokinase by substrate binding – residue contacts involved in the binding of D-glucose to the super-open form and conformational transitions ppt
... revealed the structures of the unliganded(super-open) and Glc-bound (fully-closed) states of hGK [12], the residue contacts that make essential con-tributions to the binding of Glc to the super-open ... (b) to identify the activesite residues involved in the binding of Glc to the super-open state (Fig. 1C) of this two domain [large(L) and small (S)] enzyme, and thus the site of initia-tion of ... residue, offering anexplaination for the Glc nonbinding effect of the D205A mutation.Local torsional stresses induced by Glc binding and propagation of the conformational transitionFrom the 3D...
- 15
- 522
- 0
Báo cáo khoa học: Differential regulation of fatty acid amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone pdf
... progesterone onFAAH activity and expression. (A ) Effect of leptin on the activity of FAAH in human U937andCHP100cellsandontheproteincontent and the mRNA of FAAH in U937 cells. Thesecells were incubated ... and 1 lMprogesterone enhanced FAAHactivity, protein level and mRNA content up to 500%,450% and 490% of the controls, respectively (Table 1). On the other hand, the same concentrations of ... [9].Unspecific binding was determined in the presence of 100 nMÔcold Õ leptin [27]. The expression of leptin receptor (LR) and of p rogesterone receptor (PR) in human cells wasassessed by Western...
- 11
- 468
- 0
Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx
... withXhoI, and then ligated into the XhoI site of the vec-tor downstream of the stop-codon-mutated calpain 7cDNA (AAGCTTGGTGGAAGCGGTGGTTCTCTCGAG;mutated stop codon italicized and XhoI site ... was first inserted into the ZeroBlunt TOPO PCR Cloning vector (Invitrogen), and the BamHI–EcoRI fragment was then inserted into the BamHI–EcoRI site of pGEX4T-2. The mutant of pGST–IST1MIML326D,L353Awas ... Ca2+ binding, to heterodimerization of eachsubunit, and to binding of the endogenous calpaininhibitor calpastatin [5,6]. Although the detailedmolecular mechanisms are still unknown, ubiquitouslyexpressed...
- 15
- 505
- 0
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... appears to agree with the structural conditionsfor ATP binding to human TK1. In the first crystalstructure of TK1-type enzymes of human and myco-plasmic origin [14], the feedback inhibitor dTTP ... hTK1.In the present work, the part of the phosphatedonor that is necessary for the dimer–tetramer transi-tion of native hTK1 purified from human lymphocyteswas identified. Further, the effect of the ... tetra-meric form, and that the tetramer dissociates intodimers very slowly.Results and DiscussionIdentification of the group inducingtetramerization of human TK1 Human TK1 has 234 amino acids and a subunit...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... have to be identified. Also,for a more detailed understanding of the functional and metabolic consequences, further study needs to identify the kinetic, thermodynamic and regulatoryproperties of ... acclimation to low (5 °C) and high (18 °C) temperatures leads to differential expression of alternative forms of the LDH-A gene in white skeletal muscle of weatherfish, Misgurnus fossilis.Two isoforms of ... increase ⁄ decrease the rate of poly(A) shortening, i.e. affect the lifetime of the mRNA [32], therefore it is likely that the lifetime of mRNAaldhÀa and mRNAbldhÀadiffer. Nevertheless, usingreal-time...
- 11
- 662
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP