Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

... a bacterial class I c- type cytochrome, Paracoccus denitrif-icans cytochrome c 550[33]. Moreover, many taxa thathave heme lyase apparently have separate heme lyases for the maturation of cytochromes ... 2009 FEBS Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase Vilmos ... we coexpressed S. cerevisiae cytochrome c heme lyase with either T. brucei cyto-chrome c or a CXXCH variant in the cytoplasm of E. coli (the cytochromes c from C. fasciculata and T. brucei have...

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

... boundthan the M3 in MtSTP.Crystal contacts at the active site The differential occurrence of the metal ions correlates with the conformation of the ﬂap subdomain (132–174) and the ‘binding’ of adjacent ... agalactiae PPase, kinase and adenylosuccinate syn-thase, but not in S. agalactiae CovR ⁄ CsrR. The motifis located at the surface of the SaPPase (Rantanen,unpublished), and superposition of the ... in the asymmetric unit in the SaSTP structure, and we found two catalytic metal ions (M1 and M2) in all the active sites (Fig. 2A) . Based on the coordination and lack of an anomalous signal,...

Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron ﬂavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt

... to the A- type flavoprotein family (FprA) [22]. One func-tionally and structurally characterized member of thisfamily is the bacterial cytoplasmic NO reductase,which also contains FMN and a nonheme ... in anobligate anaerobic bacteria. Arch Microbiol 181, 324–330.22 Wasserfallen A, Ragettli S, Jouanneau Y & Leisinger T(1998) A family of flavoproteins in the domains Archaea and Bacteria. ... electrondonor and acceptor specificity and the accompaniedredox mechanisms are totally different, although the structural framework, the binding mode of FMN and the di-iron center, as well as the electron...

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GAGCCATCATCATTAATAGCATCCAAAATGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTTAACAGATATGCCGGTTATT CCACCGGT GCC-3¢), GLUT46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCATATCTGTTAAGTTGTTC-3¢); GLU H44 7A, ... (5¢-ATTCAAACTATAAAGTTGACGCAACTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTTTGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTTTGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse ... H44 7A, D45 0A for- ward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTGATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A Fig. 7. Adsorption to raw starch of Glu and R1 5A, H44 7A, T46 2A, H44 7A + D45 0A mutants (A) and Glm...

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating ﬁmbrial adhesin expression in uropathogenic Escherichia coli pdf

... Stier, Anders O¨hman and Michael Murphy for their valuable discussions and critical reading of the manuscript. The work was performed within the Umea˚Centre for Microbial Research (UCMR) and was ... A bifurcated hydrogen-bonded conformation in the d (A. T) base pairs of the DNA dodecamerd(CGCAAATTTGCG) and its complex with distamy-cin. Proc Natl Acad Sci USA 84, 8385–8389.36 Zimmer C & ... Only a few contacts are formed between a1 and a5 , and include one hydrogen bond between the main chainnitrogen atom of Leu23 and the side chain Oc1 atom of Thr83, and one hydrophobic interaction...

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... to each other and to Gambeta.We ampliﬁed the cDNA for cB using forward primer5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTTACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGATAAAAATCCATCACCCG-3¢, and ... using for- ward primer 5¢-ACTTATACTACTCATATGCTCAACCCCAAGATCATC-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATGTCCCGG-3¢, to producean amplicon lacking the N- and C- terminal extensions of ... pUC-19(https://www.dna20.com/tools/genedesigner.php) plasmid. The gene was ampliﬁed from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAATCATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-TATACTATCCTCGAGCCACTGCATATCACGGATACGACGC-3¢....

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... of bacteria with their hosts.LPS i s c omposed of lipid A, a c ore oligosaccharide, and anO-polysaccharide (O-antigen) built up of oligosacchariderepeats. The structures of the O-polysaccharides ... [40] and P. tolaasii [41]. In all these bacteria, the inner c ore region has the s ame carbohydrate backbone and may differ only in th e presence and the content of diphosphate and ethanolamine ... determined based on J1,2coupling constant values for Glc, GlcN and G alN (3–3.5 and 7–8 Hz for a- andb-linked monosaccharides, respectively) and by typical1H- and 13 C- NMR chemical shifts for Rha,Hep...

Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

... tetrasacchariderepeating unit of the polysaccharide consists of two residues of GlcNAc and one residue each of GalNAc, GlcA and AlaLys. The 1Hand13 C NMR spectra of the polysaccharidewere assigned using ... the O-polysaccharide of Pr. alcalifaciens O23 [23], and an amide of the same aminoacid with D-galacturonic acid (structure 2) in the O-polysac-charides of P. mirabilis O13 [24]. An amide of D-galacturonicacid ... asanother amino component. Sugar analysis using anion-exchange chromatography demonstrated the presence of glucuronic acid (GlcA). The Dconﬁguration of GlcN and GalN was established by GLC...

Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

... 5¢-TTCCATACCACCACCTGCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGTGGTGGTATGGAACAGCATGCT-3¢ for primer 3; and 5¢-GGCCACTGGATCCAACTACAGCAATTCTCA-3¢ for primer 4 [the NdeI (primer 1) and BamHI (primer 4) sitesare ... tooverproduce a His-tagged form of SIB1 FKBP22 [8], wasused as a template. The sequences of the PCR primers usedare as follows: 5¢-AGAGAGAATTCATATGTCAGATTTGTTCAG-3¢ for primer 1; 5¢-TTCCATACCACCACCTGCAACTTGAAGCTC-3¢ ... contact with the substrate decreases. By contrast, in a mono-meric structure, the freedom of the catalytic domainincreases and therefore the opportunity of this domainto contact with the substrate increases....

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... hydrophobic environments. The spectral changeinduced by the increased concentration of TFE was nearlycomplete at about 40–60% TFE/water, and no signiﬁcantspectral change occurred upon the change of ... in a 50% TFE/water mixture, the CD spectrachanged dramatically, with a strong positive band near192 nm and strong negative bands centered at 208 and 222 nm, which are indicative of a highly a ... V13, and W16.All of the physico-chemical and structural properties of the D16W-D24)37GGN4, which are similar to those of other known amphipathic a helical antimicrobial peptides,are satisfactory...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI