Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
... is downregulated in estrogen receptor a- positive human breast cancer cell lines and clinical samples Jianhua Xiong1,*, Dianke Yu2,*, Na Wei1, Hanjiang Fu3, Tianjing Cai1, Yuanyu Huang1, ... strand5¢-UCAUCGCAUUCC UUGCAAAdTdT-3 ¢, antisensestrand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢;ERasiRNA #3 sense strand 5¢- GGAGAAUGUUGAAACACAAdTdT-3¢, antisense strand 5¢- UUGUGUUUCAACAUUCUCCdTdT-3¢. The transfection ... and preva-lent cancers in women and a leading cause of cancer- related death [11]. As in other common cancers, theformation and progression of breast cancer is a multi-step process involving...
- 11
- 237
- 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
... VanBrocklin M, McWilliams MJ, LepplaSH, Duesbery NS & Woude GF (2002) Apoptosis and melanogenesis in human melanoma cells induced byanthrax lethal factor inactivation of mitogen-activatedprotein ... An anthrax lethal factor mutant that is defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... cleavingthese mitogen-activated protein kinase kinases is to interfere with extracellu-lar signal-related kinase (ERK), p38 and c-Jun N-terminal kinase signaling.Here, we characterized an...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP CcttctccccggcggttagtgctgagagtgcARS aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat shock ... that, due to the increasedcellular abundance of HSP27, there was an overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTGMLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTGHOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCCHOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGATHOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAAHOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense ... 7411Mixed lineage leukemia histone methylases play criticalroles in estrogen- mediated regulation of HOXC13Khairul I. Ansari, Sahba Kasiri, Imran Hussain and Subhrangsu S. MandalDepartment of Chemistry...
- 12
- 518
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... that OMM-64 is contained in theHMW aggregate, which may comprise proteins and heparan sulfate glycosaminoglycan chains, althoughthe structures of the proteins and the glycosaminogly-can chains ... blotting using anti-rOMM-64 and anti-rOtolin-1 antiserawas also performed. When the affinity beads were incubated withsaccular extract, OMM-64 (arrows) and otolin-1 (arrowheads) boundseparately ... and endo -a- N-acethylagalactosaminidase (70 munits, E). The HMWaggregate was digested only by heparitinase II (arrowhead), and a 64 kDa protein band appeared instead (arrow). Some non-specificbinding was...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... (Figs 3A and 5A) . A BFig. 2. Decreased expression of heme oxygenase (HO)-1 and HO-2under hypoxia in human cancer cells. (A) Northern blot analysis ofHO-1 and HO-2 mRNA. HeLa cervical cancer and ... Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*,Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1, Tadashi Yoshida3 and Shigeki Shibahara11 Department of Molecular Biology and Applied ... of incubation in human cell lines, inclu-ding Jurkat T-lymphocytes, YN-1 and K562 erythroleukemia, HeLa cervical cancer, and HepG2 hepatoma, as judged by northern blot and western blotanalyses....
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx
... path between computer and key-board in the English Wikipedia.provides multilingual support for the English, Ger-man, French and Italian Wikipedias and can be eas-ily extended to other languages4.4 ... use-ful in many NLP applications such as word sensedisambiguation (Kohomban & Lee, 2005; Patward-han et al., 2005), information retrieval (Finkelsteinet al., 2002), information extraction pattern ... seman-tic relatedness of words in Wikipedia.1 IntroductionThe last years have seen a large amount of work in Natural Language Processing (NLP) using measuresof semantic similarity and relatedness....
- 4
- 546
- 1
Tài liệu Báo cáo khoa học: "An Approximate Approach for Training Polynomial Kernel SVMs in Linear Time" doc
... Science and Information Engineering National Central University National Central University Ming Chuan University Taoyuan, Taiwan Taoyuan, Taiwan Taoyuan, Taiwan bcbb@db.csie.ncu.edu.tw yang@cl.ncu.edu.tw ... and Marquez, 2003), shallow parsing (Kudo and Matsumoto, 2001, 2004; Lee and Wu, 2007), named entity recognition (Isozaki and Kazawa, 2002), and parsing (Nivre et al., 2006). In particular, ... successfully applied to many natural language processing (NLP) problems. They yielded very competitive and satisfactory performance in many classification tasks, such as part-of-speech (POS) tagging...
- 4
- 416
- 0
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... subunit, and in accordance withthe binding change mechanism [3], this arrangementsuggests a catalytic mechanism in which the c subunitrotates within the a 3b3cylinder. Elegant experimentshave ... 8.0, containing5mm EDTA and 1% (w ⁄ v) N-lauroylsarcosine for 10 minat 65 °C. After ultracentrifugation at room temperature,the pellet was discarded and contaminating membrane pro-teins were ... for a constant c11ring stoichiometry T. Meier et al.5480 FEBS Journal 272 (2005) 5474–5483 ª 2005 FEBS5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward),containing an NdeI site, and 5¢-CCTTTCAGGAAGCTTCCTCC-3¢...
- 10
- 477
- 0
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody againstendogenous TACE (Chemikon International, Temecula,CA). Both antibodies ... the ADAM (a disintegrin and metalloproteinase) family of type I membrane proteins and mediates the ectodomain shedding of various membrane-anchored signaling and adhesion proteins. TACE is syn-thesized ... and ADAM10 possess a- secretase activity and are proteolytically activated by PC7 and furin. Furthermore, a furin-independent and PMAinduced disappearance of mature TACE takes place which is not...
- 8
- 422
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)