0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Vật lý >

effects of dimensions on the sensitivity of a conducting polymer microwire sensor

effects of dimensions on the sensitivity of a conducting polymer microwire sensor

effects of dimensions on the sensitivity of a conducting polymer microwire sensor

... (i.e., the volume of the chamber) and the density of air at room temperature. The concentration of the methanol was calculated from the ratio between the mass of methanol and that of air inside the ... indicates how large the sensor response isto a particular concentration, and is used as a measure of the sensitivity of the corresponding sensor. Geometrically, the sensing area of a film sensor ... two dimensions. However, the th ree relationships indicate that the effects of the three geometrical dimensions on the sensitivity of a microwire sensor vary with the conducting polymer materials...
  • 9
  • 547
  • 0
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf

Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf

... and recruitment and retention programs of the armed forces. Accurate data on the relationship between performance on the one hand and ability, experience, and training on the other would allow ... technician; ”technical” positions, including aviation machinist’s mate, aviation structural mechanic, aviation ordnanceman, aviation equipment support technician, and aviation survival equipmentman; ... ”mission capable” marginal product refers to the marginal product of an individual at the ”mission capable” level of readiness, defined as the ability to complete one and potentially all of the...
  • 87
  • 627
  • 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... Malaysia consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National ... central part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges from a minimum of 25°C to a high of...
  • 88
  • 581
  • 0
Báo cáo y học:

Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"

... falciparum 3D7 clone. Concentration of DNA was determined by spectrophotometric analysis of optical density at 260nm (GeneQuant, Pharmacia) and standard DNA solutions were prepared. A standard ... the mean number of parasites when treated with 1μg mAb/ml. Anti-CSP-mAb had contradictory effect depending on concentration and although mAb at lower concentration seems to have a stimulatory ... 2% parasitaemia (87-97 % ring stage parasites) and 5% heamatocrit and were cultured for 48 hours. Percentage of parasite increase/decrease was calculated by dividing parasitaemia of treated...
  • 4
  • 524
  • 0
The Effect of Aesthetic on the Usability of Data Visualization pdf

The Effect of Aesthetic on the Usability of Data Visualization pdf

... visualization technique with the lowest aggregate aesthetic rank, averaged the highest rate of task abandonment and was among the lowest in latency of erroneous response. More than half of all participants ... mean of aesthetic rank was calculated for each of the 11 visualizations, as illustrated in Figure 4. The confidence interval of .05% determined the validity and variance of each visualization ... investigated as a directly measurable and quantifiable entity, rather than the reflection of personal judgment. Within the graph drawing discipline, as well as in most of the data visualization...
  • 9
  • 657
  • 1
Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

... displacement activity of replication protein A (RPA), and on the RNA priming and DNA poly-merization activities of the DNA polymerase -a/ primasecomplex. The results indicated that, among all the enzymes ... at an IC50value of 25 lm. The DNApolymerization activity of the DNA polymerase -a/ primase complex was measured using activated DNAas a template and a primer. The observed reduction in the ... and an average of the values was plotted together witherror bars. (B) Effect of increasing concentrations of heliquinomycin on the DNA polymerization activity of the DNA polymerase -a/ prim-ase....
  • 10
  • 538
  • 0
Báo cáo khoa học: The influence of cholesterol on the interaction of HIV gp41 membrane proximal region-derived peptides with lipid bilayers potx

Báo cáo khoa học: The influence of cholesterol on the interaction of HIV gp41 membrane proximal region-derived peptides with lipid bilayers potx

... which has a + 2 net formal charge, and the negatively charged lipid. For MPRP-I, the partitionconstant increase was not as high and in the case of MPRP-S the partition constant remained unchangedrelative ... presence of (a) MPRP-C, (b) MPRP-I and (c) MPRP-S. The spectra wereobtained by subtracting the excitation spectrum before the addition of peptides from the excitation spectra after addition of the ... fluorescence quantum yield is dependent on the polarity of the microenvironment of the Trp resi-dues, as well as on the peptide conformation. Both areaffected upon insertion of the peptides in membranes.Additionally,...
  • 9
  • 286
  • 0
RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx

RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx

... appropriate.• The person against whom allegations are made should be given details of the allegations in writing, the nature of the evidence against them, and begiven reasonable time and opportunity ... each of the following:FabricationThis includes the creation of false data or other aspects of research, includingdocumentation and participant consent.FalsificationThis includes the inappropriate ... professionalbodies;• be drawn to the attention of all staff on appointment;• be easily available at all times in guidance manuals and on websites.Clear managerial arrangements• ROs should have published...
  • 16
  • 390
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan ... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram...
  • 15
  • 635
  • 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... NRG-5¢_forNRG-Beta_revTCTCCGGCGAGATGTCCGAGGCAGCGATCACCAGTAAAC677GAPDH GAPDH_forGAPDH_revGAAGGGCTCATGACCACAGTCCATTCATTGTCGTACCAGGAAATGAGCTT450Fig. 2. Proteolytical processing of APP and NRG-1 in U373 ... NRG-jD_forNRG-TM_revTGAAAGACCTTTCAAACCCCTCGTTTTGCAGTAGGCCACCACApproximately 200(depending on isoform)Immunoglobulin domain(type I and II)NRG-IG_forNRG-TM_revGCCAGGGAAGTCAGAACTTCGTTTTGCAGTAGGCCACCAC543Glycosylation ... coexpression of this enzyme [35]. Cleavage of the a2 isoform of NRG-1, on the other hand, wasimpaired in fibroblasts with catalytically inactiveADAM17 [30].b- and c-secretase are responsible...
  • 13
  • 487
  • 0

Xem thêm

Từ khóa: dynamic effects of a temporary increase in liquidity in the rest of the world on a small open oil exporterthe gain or loss for the company on the transaction and a description of the functions and risks assumed in the transaction by each related partythe gain generated or loss incurred by the company on the transaction and a description of the functions and risks assumed in the transaction by each related partyan illustration of the effect of climate change on the oceanwave climate a stochastic modelthe more trips that are made by public transport reduces the number of trips that are made by private vehicles leading to less congestion on the roads and a more efficient road systemexperimental evaluation of the preventive and therapeutic effects of a moisturizereffects of a single low and high dose cyc on 5t2mm progressionthe health effects of a psychosocial work stressoron the transition to a higher degree of mechanizationfor each situation in brackets write a sentence with should or shouldn t one of the phrases in the box below go away for a few days go to bed so late look for another job put some pictures on the walls take a photograph use her car so muchleftmost arc is the same arc as figure 9 12 with a startangle of 90 arc on the right has a modified bounding boxfick s second law of diffusion equation 3 1 9 40 which is based on a one dimensional model that demonstrates the effect of diffusion on the concentration in a container as well as the rate at which the amounclick on the drop down arrow beneath the new slide button in the slides group on the home ribbon a menu with the different layout types of slides will appear2surface energy and the wetting of a solid polymer surfaceantioxidant anticancer activity and other health effects of a nutritional supplement galaxy rchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ