Báo cáo khoa học: "Lexical Normalisation of Short Text Messages: Makn Sens a #twitter" pptx

... LinguisticsLexical Normalisation of Short Text Messages: Makn Sens a #twitterBo Han and Timothy BaldwinNICTA Victoria Research LaboratoryDepartment of Computer Science and Software EngineeringThe ... 145–148, Sapporo, Japan.Joseph Kaufmann and Jugal Kalita. 2010. Syntactic nor-malization of Twitter messages. In International Con-ference on Natural Language Processing, Kharagpur,India.Dan Klein ... training data, but is able to lever-age context for lexical normalisation. Our approachﬁrst generates a list of candidate canonical lexicalforms, based on morphological and phonetic vari-ation....

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1 ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo ... primers: KGG3-2 forwardd(AAA GGT GGC AAA GGT GGA GAC AGA GGTGGC TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers:...

Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

... Reid GE, Karunarathne WK& Spence DM (2008) Metal-activated C-peptide facili-tates glucose clearance and the release of a nitric oxidestimulus via the GLUT1 transporter. Diabetologia 51,175–182.28 ... temperature of 25 °C on a Bruker Avance spectrometer equipped with a broad band inverse probe operating at a 1H Larmorfrequency of 400 MHz. Increasing amounts of SDS wereadded to samples containing ... observation that self-asso-ciating peptides and proteins are at the core of severalneurodegenerative diseases has led to a massive effortaiming to understand the physiologically relevantstructures...

Tài liệu Báo cáo khoa học: The sequentiallity of nucleosomes in the 30 nm chromatin ﬁbre pptx

... that diffuses out of the nucleiafter micrococcal nuclease (MNase) digestion is in the30 nm ﬁbre conformation. It consists of a regular helixwith a diameter of approximately 33 nm and a variablemass ... octa- and nonanucleosomes and half the amount of hexa- and decanucleosomes (6- to 10-mer sample). (A) (a) Nonamer of a sequential single helix. (b, c) Sedimentation proﬁles after crosslinking and ... penta-nucleosomes are of negligibleamounts due to the larger size of the starting material.Absorbance at 254 nmFEDCB A S123456asDistance from top of the gradientFig. 3. UV absorbance...

Tài liệu Báo cáo khoa học: Thermal unfolding of smooth muscle and nonmuscle tropomyosin a-homodimers with alternatively spliced exons docx

... case of Tm–F-actin complexes, the final concentration of F-actin was46 lm. F-actin was stabilized by the addition of a 1.5-foldmolar excess of phalloidin (Sigma) to obtain a better separ-ation ... muscle a- Tm was shown to increase the actin affinity of a- Tm[5], and the same exon exchange has a similar effectbetween fibroblast Tm 5a and 5b isoforms [6]. Thisreplacement in rat fibroblast a- Tm has ... of the maximum of thermal transition (Tm), and calorimetric enthalpy(DHcal) was calculated as the area under the excess heatcapacity function.The DSC data, with instrumental baseline deducted,...

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435,Sydney, July 2006.c2006 Association for Computational Linguistics428 0.5 1 1.5 ... 4 5 6 7 8entropyoffset429430431432 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1recallprecisionBincreaseBordinaryBmax433 0 0.1 0.2 ... 1recallprecisionBincreaseBordinaryBmax433 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 10 100 1000 10000 100000 1e+06size(KB)recallprecision434...

Tài liệu Báo cáo khoa học: "The Use of Shared Forests in Tree Adjoining Grammar Parsing" pptx

... and Lang [1992] we use grammars as a means of recording all parses. Billot and Lang used context-free grammars (cfg) for representing all parses in a cfg parser demonstrating that a shared ... adjoining (SA) constraint that determines the set of auxiliary trees that can be adjoined at that node. In addition when adjunction is mandatory at a node it is said to have an obligatory adjoin- ... of all parses and suggests how this can be applied to tag. This paper examines this approach to tag parsing in greater detail. In particular, we show that *We are very grateful to Bernard...

Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx

... University of Arizona ExperimentStation Funds, and American Cancer Society Faculty Research Award#FRA-420 to E. V. G. J. L. was a recipient of a National Institutes of Health Postdoctoral Fellowship. ... molecular chaperone activity [1]. sHsps aredeﬁned by a conserved C-terminal domain of  90 aminoacids, called the a- crystallin domain, which is ﬂanked by a short C-terminal extension and a variable ... element analysis of thedata [28] estimates a molecular mass of 201 kDa forTaHsp16.9C-I and 173 kDa for TaHsp17.8C-II. These dataare consistent with a more extended shape for TaHsp16.9C-Ithan for...

Báo cáo khoa học: "Semantic Types of Some Generic Relation Arguments: Detection and Evaluation" pptx

... Arguments:Detection and EvaluationSophia KatrenkoInstitute of InformaticsUniversity of Amsterdamthe Netherlandskatrenko@science.uva.nlPieter AdriaansInstitute of InformaticsUniversity of Amsterdamthe ... one starting state and a separate sequence of states for each positive exam-ple and then uses a merging strategy such that nonegative examples are accepted.Similarly, for a positive example ... into account a semantic category of the other. In particular, onecan represent a binary relation as a bipartite graphwhere the corresponding nodes (relation arguments)are connected. A natural...

Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

... Tagged Data Set, manually pro-duced by Rada Mihalcea and Li Yang (Mihalcea,2003), from text drawn from the British NationalCorpus. We calculated a ‘supervised’ baselinefrom the annotated data by ... Topic signatures can be useful in a number of Natural Language Process-ing (NLP) applications, such as WordSense Disambiguation (WSD) and Text Summarisation. Our method takes ad-vantage of the ... mappings of wordsand meanings are different in different languages.Gale et al. (1992) proposed a method which au-tomatically produces sense-tagged data using par-allel bilingual corpora. Diab and...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ