0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx

Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx

Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx

... buffer were obtained from Fermentas(St Leon-Rot, Germany).RNA preparationThe sequence of primer P1 (promoter primer) is 5¢-TAATACGACTCACTATAGGGTACGCTGAAACAGA-3¢, and that of primer P2 (reverse ... world’or in an early stage of the development of life, whensmall RNA would have played a major role. Popula-tions of small RNA could have interacted randomlywith small metabolites of all kinds ... fraction of cleaved RNA at time t, and kobsthe observed cleavage rateconstant. Keqwas taken as the cleaved ⁄ uncleaved RNAconcentration ratio. The error bars applied to the rateconstant values...
  • 15
  • 318
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Bootstrapping a Stochastic Transducer for Arabic-English Transliteration Extraction" pdf

... 2002) or(AbdulJaleel and Larkey, 2003) require a large set of sample transliterations to use for training. If such a training set is unavailable for a particular languagepair, a detection algorithm ... transliterations of the units are assessedmanually from a set of training pairs. For eachkatakana string in a bitext, all possible translitera-tions are produced based on the transliteration ... for many language pairs, and the gen-eration of all possible transliteration candidates isproblematic in terms of computational complexity.Lee and Chang (2003) detect transliterations witha...
  • 8
  • 389
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... in bothanswers, and AllIds is the number of different idsin both answers. We calculated the overall averageagreement ratio (Total Avg) and the average of thebest matches between two assignments ... human evaluation (Lin and Hovy,2003).Overlaps of higher order N-grams are more usablewithin speech summarisation as they take the gram-matical structure and fluency of the summary intoaccount. ... Scholar-ship of Japanese Government and the 21st CenturyCOE Program ”Framework for Systematization and Application of Large-scale Knowledge Resources(COE-LKR)”ReferencesYllias Chali and Maheedhar...
  • 9
  • 610
  • 1
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... were analyzed manually and automatically bySEQUESTsoftware. The acquisition and deconvolution of data were performed with theXCALI-BURsoftware on a Windows NT PC data system.Determination of ... obtained from data bank and the abbreviations stand for: AaH, Androctonus australisHector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occitanus tunetanus;Cn,Centruroides ... show vast differences in p reference f or insect and mammalian Na+channels. Accordingly, they are dividedinto classical a- toxins that are highly active in mammalianbrain, a- toxins that are...
  • 9
  • 533
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx

... patterns of agree-ment and disagreement (Hawes et al., 2009; Abbottet al., 2011), and relationships among conversationalparticipants (Ireland et al., 2011).One of the most natural ways to capture ... al.,2010) and tools that summarize (Murray et al., 2005) and display (Ehlen et al., 2007) conversational data.Topic segmentation also can illuminate individuals’agendas (Boydstun et al., 2011), patterns ... DebatesOur sec-ond dataset contains three annotated presidential de-bates (Boydstun et al., 2011) between Barack Obama and John McCain and a vice presidential debate be-tween Joe Biden and...
  • 10
  • 555
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

... classifica-tions. The baseline is calculated, for each task, asthe average value of the Adjusted Rand measure for100 random cluster assignations. Although all thetasks perform better than the baseline, ... value of all the datapoints, in order to get an indication of the overallquality of the clusters created. The main difficulty inevaluating unsupervised classification tasks against a gold standard ... extracting from the corpus pairs made of a verb and its co-occurring constituents that are a possible pattern of a frame, and then filtering outthe patterns that do not have a probability of co-occurrence...
  • 6
  • 418
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx

... we addtwo NLP-oriented features, as described below: a statistical language model and a measure of tensedifficulty.4.1 The language model The lexical difficulty of a text is quite an elaboratephenomenon ... investigation.This research is still in progress, and furtheranalyses are planned. The predictive capacity of some other lexical and grammatical features willbe explored. At the lexical level, statistical ... textbooks as a corpus. With the appearance of the CEFR, FFL textbooks have undergone a kind of standardisation and their levels have been clari-fied. It is thus feasible to gather a large number of documents...
  • 9
  • 514
  • 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag ... GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K2 4A F gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg...
  • 15
  • 532
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc

... Evaluation of Association Measures2.1 State -of- the-art A standard procedure for the evaluation of AMs ismanual judgment of the -best candidates identi-fied in a particular corpus by the measure ... amonglow-frequency data.(2) The evaluation strategies applied: Instead of examining only a small sample of -best can-didates for each measure as it is common practice,we make use of recall and precision values ... curves.The major drawback of an approach where alllow-frequency candidates are excluded is that a large part of the data is lost for collocation extrac-tion. In our data, for instance, 80% of the...
  • 8
  • 516
  • 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... Subbuswamy K. Prabu1,*, Cynthia M. Otto2 and Narayan G. Avadhani11Department of Animal Biology and 2Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania,Philadelphia, ... with Apo-ferritin and b-amylase. Based on the rates of migration, the slowmigrating complex may be a dimmer and the fastermigrating complex migrating with an apparent molecularmass of 200 kDa ... requires a high concentration of ATP (0.5–1 mM) for maximal activity. Narasimhan and Attardi [41] showed that a high concentration of 5¢-adenylylimidodiphosphate was able to stimulate theTable...
  • 9
  • 554
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ