Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identiﬁcation of kinase substrates doc

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

... mMsodium orthovanadate and then assayedfor phosphorylation activity. (E) Phosphoamino-acid analysis of PknA. MBP–bgal control (lanes 1 and 3) and MB P–PknA fusion protein (lanes 2 and 4) after Western-blot ... PAPEREvidence that a eukaryotic- type serine/threonine protein kinase fromMycobacterium tuberculosisregulates morphologicalchanges associated with cell divisionRachna Chaba, Manoj Raje and ... functionality of any eukaryotic- type Ser/Thr kinase from M. tuberculosis. Identiﬁcation of thenatural substrate of PknA in mycobacteria would a idprogress towards its utilization as a drug target,...

Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for ampliﬁcation of mitochondrial apoptotic cell death in human cervical cancer cells pptx

... frommitochondria, and apoptotic cell death. Radiation also induced transcrip-tional upregulation of Fas, caspase-8 activation, Bax and Bak activation, and phosphorylation and downregulation of Bcl-2. ... effector domain (DED)domains of the adaptor molecule, Fas-associated deathdomain (FADD), and caspase-8. We performed co-immunoprecitation assays to analyze the association of FADD and caspase-8 ... anti-cytochrome c, anti-AIF and anti -a- tubulin serum. a- tubulin was used as a cytosolic marker protein. (C) Radiation induces apoptotic conformational changes of Bax and Bak after irradiation(10 Gy). Activity-related...

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... interactor, isoform 1 (PPI1) is a novel interactor of the C-ter-minus of Arabidopsis thaliana plasma membrane H+-ATPase (EC 3.6.3.6)(Morandini P, Valera M, Albumi C, Bonza MC, Giacometti S, Ravera ... further enhances FC-stimulatedH+-ATPase activity [22].Here we report a characterization of the interaction of PPI1 with the H+-ATPase in PM isolated fromcontrol and FC-treated A. thaliana cultured...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢;...

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, HirataM, Mazda O, Katsura Y & Narumiya S (1993)Thromboxane A2 receptor is highly expressed in mouseimmature thymocytes and mediates DNA fragmentation and apoptosis. ... pGL3e:Prm3AP)1*, pGL3b: Prm 3a AP)1*, pGL3e:Prm 3a AP)1*,pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b:Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1*.Mutation ... (TP) alpha and beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of the 5¢ untranslated region of alpha and betaisoforms of...

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

... three sets of primers: ﬁrst set, A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR products ... xTRHR1 and xTRHR2 subtypes were ampliﬁed as described above usingpartially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-ampliﬁed ... that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site.The ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid ... puriﬁcation of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichiapastoris. Lane 1 shows standards (Low range and Polypeptide kits,Bio-Rad, France) and lanes 2–5 are...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase fromSaccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... Glu545Leu variant of ScPPDCwas prepared, and its kinetic parameters with the two substrates, PPA and IPyA, were determined. A com-parison of these and the parameters of the wild -type enzyme are presented ... kcatvalue for reaction of each variant with PPA islower than that of the wild -type enzyme and, with theexception of Q448W, Kmvalues are increased and kcat⁄ Kmvalues are reduced by almost...

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... localization and induction by highlight. MolMicrobiol 69, 231–244.41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J(2007) Identiﬁcation and biochemical characterization of a novel carotenoid ... ends of carotenoids.AbbreviationsCCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1,Oryza sativa carotenoid cleavage ... claim to original German government works 747 Characterization of the rice carotenoid cleavagedioxygenase 1 reveals a novel route for geranialbiosynthesisAndrea Ilg, Peter Beyer and Salim Al-BabiliFaculty...

Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... GATCATGCACTGAAATTTA (2), GATGAAACCTCTCAAACTG (3), and CATCATCGCTGGACAATGT (4)], usingT. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1CFEBS Journal 274 (2007) 4812–4824 ª 2007 The Authors ... Dunkern and A. Hatzelmann Characterization of inhibitors of phosphodiesterase 1C on a human cellular systemTorsten R. Dunkern and Armin HatzelmannBiochemistry 2 Inﬂammation, ALTANA Pharma AG, Member ... LifeTechnologies, Grand Island, NY, USA), 2 mml-glutamine,1mm sodium pyruvate and 10% heat-inactivated fetalbovine serum at 37 °C and 5% CO2.Measurements of PDE isoenzyme activities and preparation of cellular...

Xem thêm