Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... 2387 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja Shahi* † , Ish Kumar* ‡ , Ritu Sharma, Shefali Sanger and Ravinder S. Jolly Institute of Microbial ... the abnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application in chemo...
Ngày tải lên : 16/03/2014, 13:20
  • 14
  • 513
  • 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

... were routinely reared on the standard artificial diet described by Bown et al.[12]. Purification and characterization of carboxypeptidases from H. armigera larval gut extract Gut extract was prepared from ... and analysed by SDS/PAGE. Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl...
Ngày tải lên : 23/03/2014, 12:20
  • 12
  • 458
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... obtain the full length sequence: OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢; OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG- 3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACG TG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAA...
Ngày tải lên : 19/02/2014, 07:20
  • 14
  • 523
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6 [32]. We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligan...
Ngày tải lên : 21/02/2014, 03:20
  • 11
  • 642
  • 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... is an economically important s pecies, in particular because of i ts propagation on a large scale a nd utilization for silk production. Here, we describe the isolation and characterization of a novel ... Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactiv...
Ngày tải lên : 22/02/2014, 04:20
  • 7
  • 470
  • 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae Malea M. Kneen 1 , Razvan Stan 1 , Alejandra Yep 2 , ... 182–191. 26 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search program...
Ngày tải lên : 06/03/2014, 00:21
  • 12
  • 436
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar- aman L (2008) Pyrazole inhibitors of coactivator associ- ated arginine methyltransferase 1 (CARM1). ... transcription, protein and RNA subcellular localization, RNA splicing, DNA damage repair, and signal transduction [2]. Nine PRMT family members have been cloned and characterized to date, w...
Ngày tải lên : 06/03/2014, 11:20
  • 13
  • 646
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 772
  • 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3, 141–147. 43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of ... importantly, two local maxima of  330 and 380 nm were also revealed. These maxima are typical of diiron-centre absorbance, and thus characteristic for all haemerythrins [12]. This str...
Ngày tải lên : 07/03/2014, 17:20
  • 13
  • 501
  • 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... specific radioactivity of the 125 I-labelled PA1b, calculated by the ratio of the radioactivity measured by gamma counting and the amount of peptide evaluated by absorbance at 210 nm during HPLC analysis, ... PA1b: five susceptible strains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamais LS, and S. granarius BrayardÕ and four fully resistant S. oryzae strains ÔISOR3, Mex1, China and GVÕ ha...
Ngày tải lên : 08/03/2014, 02:21
  • 7
  • 604
  • 0

Xem thêm

Từ khóa: