Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... DosH as a template
and using the following respective 5¢-sense primers: 5¢-gatga
gtcgggagACCcagctggagaaaaaag-3¢,5¢-gatgagtcgggagTTTcag
ctggagaaaaaag-3¢,5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢,
and ... Journal compilation ª 2006 FEBS 1223
Critical roles of Leu99 and Leu115 at the heme distal side
in auto-oxidation and the redox potential of a heme-
r...
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... oligonucleotides: Asp40Ala:
5¢-TGTTAATTAACGAAAATGC TGAAGTGATGTTTT
TC-3¢ (forward); 3¢-GAAAAACATCACTTC AGCATTT
CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT
AATTAACGAAAATAAC GAAGTGATGTTTTTCA
AC-3¢ (forward); ... Critical roles of Asp40 at the haem proximal side of haem-regulated
phosphodiesterase from
Escherichia coli
in redox potential,
auto-oxidation and cataly...
Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx
... deprotonating the C2 hydroxy group to
form an oxaloacetate intermediate and in facilitating
the hydride transfer from C2 to NADP
+
. After
decarboxylation of oxaloacetate, a general acid partici-
pates ... with the carbonyl oxygen of oxaloacetate and
facilitate the decarboxylation reaction to form enol-
pyruvate [21]. Our kinetic data on the D23 5A mutant
demonstrated...
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
... study, the
catalytic domains are indicated by capital letters ( A and
B) and the C-terminal peptides by lower case letters (a
and b), so that the wild-type enzymes are abbreviated as
Aa and Bb. The ... protein or alkaline phos-
phatase allowed the formation of tetramers associated
with an N-terminal fragment of ColQ [17]. However,
the catalytic domains are also invo...
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... be
involved. In multicellular organisms, GATA-binding
factors play critical roles in development, including
cell-fate specification, regulation of differentiation, and
control of cell proliferation and ... loops of c-T1 and c-T2 pro-
mote the lateral interactions necessary to form the
c-TuRC ring template at cold temperatures [12,35]
and that the residue substitut...
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx
... (5¢-atagacacgcaaacacaaatacaca
cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG
CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg
aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC
CAGC-3¢).
The sequences in lower-case ... was
generated by disrupting the ATF2 gene of CA10 with the
KanMX4 cassette, which confers G418 resistance. Primers
5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT
CAGCAATAAAAATTGTC...
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... (5¢-to3¢) Mutant
GSTU1 E117K-for: AAGACATGGACCACA
AAGGGAGAAGAGCAGGAG
E117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATC
RKI
GSTU2 P89R-for: TGGCTTCCCTCTGATC
GCTACCAGAGAGCTCAA
P89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC
RKV
GSTU1 ... TTGCTTCCCTCTGATC
CCTACCAGAGAGCTCAA
R89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC
PEI
PEI E117K-for: TTTGGAAAGTCCAGC
ATTGAGGCTGAGTGCCCC
E117K-rev: GCTGGACTTTCCAAATGTCTCATA
PKI
Functional ro...
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx
... yields information on the
chemical nature of the individual radicals of the radi-
cal pair state, and their interaction with each other
and with their immediate surroundings.
EPR ⁄ ENDOR investigations ... Thus, replacement of His354 by alanine
leads to significant modification of the cofactor-
binding site at the 8a- methyl group and at the linkage
of the ribi...
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot
... with
other flavin amine oxidases, including the overall fold of the amine oxidase
domain region and details in the active site that are relevant for amine
substrate oxidation.
Abbreviations
AOD, amine ... whereas in MAO A,
MAO B and MAO N the aromatic substrates bind in
a hydrophobic cavity that, in MAO B (Fig. 3A) , has a
bipartite nature and is shaped by a loo...
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx
... state governs the association of
Yap4p and Lot6p. Although it appears likely that the
redox state of the FAD cofactor of NQO1 and
NQO2 plays a similar role in the mammalian system,
unequivocal ... protein [24], removing ubiquitin chains
for recycling [25,26] and opening an axial gate into the
20S catalytic chamber [27]. Whereas 26S proteasomal
degradation requires...
Từ khóa:
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật