Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

... 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ligated into ... localization of MPP3, a novel member of the MPP5 protein scaffold at the outer limiting membrane (OLM), and of the DLG1 protein scaffold at the outer plex...
Ngày tải lên : 16/03/2014, 13:20
  • 14
  • 449
  • 0
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... entities. In other words, the sub-tree is enclosed by the shortest path linking the two entities in the parse tree (this path is also commonly-used as the path tree fea- ture in the feature-based ... trees. Their tree kernels require the match- able nodes to be at the same layer counting from the root and to have an identical path of ascend- ing nodes from the...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 467
  • 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... subtilis enzyme, although this part of a-helix E is distorted and the histidine points to the exterior of the proteins, towards the solvent. All these previous observations suggest that the active ... conservation of the residues known until now to be involved in the catalytic mechanism, another significant difference is present in the H. pylori enzyme. In the latter...
Ngày tải lên : 16/03/2014, 00:20
  • 9
  • 491
  • 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

... located at the 5¢ untranslated region of the PABP- mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissoci- ation ... ribonucleoprotein complex at the ARS of PABP mRNA. Abbreviations ARC, autoregulatory ribonucleoprotein complex; ARS, autoregulatory sequence; IMP1, insulin-like growth factor...
Ngày tải lên : 23/03/2014, 10:20
  • 13
  • 466
  • 0
Báo cáo khoa học: On peptide bond formation, translocation, nascent protein progression and the regulatory properties of ribosomes ppt

Báo cáo khoa học: On peptide bond formation, translocation, nascent protein progression and the regulatory properties of ribosomes ppt

... consistent with the universal nature of the tRNA A- to P-site passage. This requirement is somewhat released when the participa- tion of the phosphate, rather than the base is required, as is the ... forms a scaffold that guides the motion from the A- to the P-site (Fig. 3). This guidance, together with the front-side anchor- ing, provides the precise path fo...
Ngày tải lên : 23/03/2014, 17:22
  • 14
  • 337
  • 0
Báo cáo khoa học: Irregular dimerization of guanylate cyclase-activating protein 1 mutants causes loss of target activation ppt

Báo cáo khoa học: Irregular dimerization of guanylate cyclase-activating protein 1 mutants causes loss of target activation ppt

... are myristoylated at the N-terminus, but they do not undergo a Ca 2+ –myristoyl switch as do other NCS proteins such as recoverin and hippocalcin [10,11]. However, they change their conformation ... excess Ca 2+ in the protein sample over that present in the ultrafiltrate. The data were analysed as follows: ½Ca 2þ  free ¼ðR f =R p Þ½Ca 2þ  total where R f is the radioactivit...
Ngày tải lên : 30/03/2014, 15:20
  • 9
  • 183
  • 0
Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

... requirement to ensure that the effective dissociation constants match the protein concentrations in vivo. One can speculate on the hypothetical advantages of a regulation mechanism based on the equilibrium between ... sug- gests that the conserved feature is, indeed, the forma- tion of a dimer, and rules out the alternative explanation that dimer formation is a necessary...
Ngày tải lên : 16/03/2014, 02:20
  • 12
  • 252
  • 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGA...
Ngày tải lên : 23/03/2014, 04:20
  • 14
  • 456
  • 0
Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc

Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc

... by the fact that they are able to target passenger proteins to the appropriate organelle. The receptor machinery on the outer membranes of chloroplasts and mitochondria is able to discriminate ... in which isolated mitochondria and chloroplasts from pea are mixed together and incubated with the precursor proteins, and then the organelles are re-separated. The authors r...
Ngày tải lên : 23/03/2014, 12:20
  • 8
  • 378
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... synthesis [15,16]. It follows that, unless there are other unrecognized d 1 biogenesis proteins, then NirF must catalyse the last step(s) in d 1 heme synthesis. The nature of these synthesis ... the resulting d 1 heme then being translocated to the periplasm. In the case of P. pantotrophus it would be the substrate for NirF that is translocated. In either case the transport...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0

Xem thêm

Từ khóa: