Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx
... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... APN1AAF08254 HviAAN75693 Har APN1AAF37558 Hpu APN1AAC33301 Bmo Q11001 Mse A pisum APNCAA66467 PxyAAX39864 Tni APN2AAD31184 Ldi APN2BAA32140 Bmo P91885 Mse APN2CAA10950 PxyBAA33715 BmoAAX39866 ... aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins Plinio T. Cristofoletti1, Flavia A. Mendonc a de Sousa2, Yvan Rahbe´2and Walter R....
- 15
- 391
- 0
Tài liệu Báo cáo khoa học: Characterization of phycoviolobilin phycoerythrocyanin-a84-cysteinlyase-(isomerizing) from Mastigocladus laminosus pdf
... the confor-mation of chromophore, to a form suitable for the PVB-PEC-lyase to act on, and unfavourable for PecA to bindspontaneously to PCB. Changes of the conformationalequilibria of bile ... His6-PecA was decreased 15%. However, in thiscase a small amount of the ligation/isomerization product,His6 -a- PECA, was formed (7% as compared to themaximal yield of His6 -a- PecA in the ... of nucleotides and cofactors of many related enzymes. Thecatalysis by Mn2+was therefore tested in the presence of ATP and or GTP (data not shown). However, neitherincreased the activity of catalysis...
- 9
- 468
- 0
Báo cáo khoa học: Characterization of the cofactor-independent phosphoglycerate mutase from Leishmania mexicana mexicana docx
... usingTURBOSEQUEST(ThermoFinnigan) databasesearch engine or manually with the help of XCALIBURsoftware (ThermoFinnigan). Search parameters incorpor-ated a mass difference of 72.00 atomic mass units for N-carbethoxyhistidine ... Virtually all mutase activitymeasured in the supernatant was vanadate resistant andtherefore due to i-PGAM. The supernatant was thenpassed through 1.5 mL of TALON (Clontech) resinpacked in a ... staining. A major band of approximately 60 kDa appeared at 10 and25 mMimidazole fractions, and were pooled separately for further assays.To determine optimal storage conditions of C-LmPGAM, its...
- 13
- 448
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... quantitative analysis of the RP-HPLC profilesshowed that the rates of disappearance of the reducedforms are similar but not identical (Fig. 4A) . A fit of experimental data with a three-parameter ... peptidesf2–f6 was carried out on the same Gilson chromatographicapparatus using a PrePak Cart ridge 25 · 100 m m (Agilent)casted on a PrepLC Un iversal Base apparatus (Waters) and a Zorbax 300SB-C18 ... structureelements. A qualitative analysis of the spectra suggests theabsence of helical structure, and a dominant component of irregular structure in all the peptides. A quantitative analysis of secondary...
- 12
- 416
- 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... primers: gatggatcccatATGGGTGTTGAAGTTGTA annealing around the start codon of thePpi1 ORF and gactcgagATTAGTCGACTTCTTACGCannealing just before the putative transmembrane domain(capital letter ... C-terminus of isoform 1 of the PM H+-ATPase of A. thaliana (AHA1) interacts with the first 88 aminoacids of PPI1 [22], indicating that the PM H+-ATPase binding site of PPI1 is localized therein....
- 8
- 629
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢;...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Aiba Y, Nakamura K, Namba T, HirataM, Mazda O, Katsura Y & Narumiya S (1993)Thromboxane A2 receptor is highly expressed in mouseimmature thymocytes and mediates DNA fragmentationand apoptosis. ... pGL3e:Prm3AP)1*, pGL3b: Prm 3a AP)1*, pGL3e:Prm 3a AP)1*,pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b:Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1*and pGL3e:Prm3aaaAP)1*.Mutation ... (TP) alpha and beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of the 5¢ untranslated region of alpha and betaisoforms of...
- 18
- 509
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site. The ... that probably resultedin a compact conformation that was resistant to cleavage.CD analysis and oligomerizationThe far-UV CD spectrum of ASP3c at neutral pH (Fig. 5A) displayed a positive peak...
- 11
- 642
- 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx
... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... an‘instant’ PDC. It appears that it will be easier toexpand the active site to accept larger substrates and,as shown for benzoylformate decarboxylase [16], satu-ration mutagenesis of at least ... the calculated molecu-lar mass of 72.3 kDa determined from the translatedamino acid sequence. However, the ScPPDC samplewas clearly larger than an authentic sample of BFDC from P. putida (57.4...
- 12
- 436
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... localization and induction by highlight. MolMicrobiol 69, 231–244.41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J(2007) Identification and biochemical characterization of a novel carotenoid ... M, Azulay Y, Portnoy V, Wasserman B, Bar E,Meir A, Burger Y, Hirschberg J, Schaffer AA, Katzir Net al. (2006) Functional characterization of CmCCD1, a carotenoid cleavage dioxygenase from melon. ... revealed the C7¢–C8¢ dou-ble bond of linear and monocyclic carotenoids to bean additional novel cleavage site of OsCCD1, leadingto geranial and indicating a novel plant route for theformation...
- 12
- 497
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015