Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B,Xuan X & Fujisaki K (2006) Molecular cloning andfunctional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis. ... Russia, eastern Asia, Austra-lia, and New Zealand, and has the potential totransmit pathogens including viruses, rickettsia andprotozoan parasites that cause important human andanimal diseases ... (GenBank acces-sion no. AAY27740); A. t., Arabidopsis thaliana (NP_194790); Ye, Saccharomyces cerevisiae carboxypeptidase Y (CAA56806); Mo, mousecathepsin A (AAA39982); Hu, human cathepsin A (NP_000299);...

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starﬁsh embryogenesis ppt

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...

Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx

... instead of FAD, or NADPH instead of NADH no NoxC activity was found For this reason,further purification and characterization of NoxC wasabandoned.Purification of the recombinant enzymesNoxA-1 and ... [19]. The reaction wasstarted upon addition of anoxic NADH. The decrease inoxygen concentration was calculated from the decrease inNADH, assuming that for each mole of NADH one mole of O2was ... from a fit of the data(exponential decay: y ¼ a e–bx).Results Characterization based on amino acid sequence The sequences of the three NADH oxidases from A. fulgi-dus that were investigated...

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus inﬂuenzae pot

... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relativeabundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... methylation analysis, on the basis of the chemical shift data and the large J2,3, J3,4and J4,5values( 9 Hz). On the basis of low J3,4and J4,5values (<4 Hz)and chemical shift data, the ... Group and Department of Paediatrics, Weatherall Institute of Molecular Medicine,John Radcliﬀe Hospital, Oxford, UKStructural analysis of the lipopolysaccharide (LPS) from nontypeable Haemophilus...

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... intracellular and extracellularcompartments [5]. Adeno sine kinase ( AK), which catalyzes the transfer of the c-phosphate from ATP to the 5¢-hydroxyl of Ado, generating AMP and ADP, is one of severalenzymes ... National Institute of Drug Abuse (JAB), t he National AllianceforResearchonSchizophreniaandDepression(JAB),theNationalInstitute of Mental Health (ACN and RWG), the Department of Defense (JAB ... Molecular characterization of recombinant mouse adenosine kinaseand evaluation as a target for protein phosphorylationBogachan Sahin1, Janice W. Kansy1, Angus C. Nairn2,3,...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 ... 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ ... containing PHD domain;unknown functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conﬂict of this ﬁnding with the absence of a coordinating carboxylate ... catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bondcleavage to yield methylglyoxal and acetate.Kinetic characterization of Fe2+Bxe _A2 876 The activity of Bxe _A2 876...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data notshown). The estimated association constants for imi-dazole and azide binding to heme–GmHO-1 are sum-marized and compared ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu O from Corynebacterium...

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... mutagenesis.Roles of Asn266Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in the class A b-lactamase ... densitymap was poor for the C-terminal half of Ald [12]. Incontrast, in Hyb-24D -A 112–Ald and Hyb-24DNY- A 112–Ald, the catalytic and binding residues and Aldin the catalytic cleft had clear electron ... structure (a and a ⁄ b)that is similar to the folds of the penicillin-recognizingfamily of serine- reactive hydrolases, especially to those of the d-alanyl-d-alanine (DD) carboxypeptidase from Streptomyces...

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... Guimaraes da Costa F, Paschoal ME,Ronco LV, Carvalho MG & Pardee AB (1999) Identiﬁ-cation of a gene encoding a human oxysterol-bindingprotein-homolog: a potential general molecular markerfor ... enhanced chemiluminescence (AmershamBiosciences).AcknowledgementsThis work was supported by a Young InvestigatorAward from the National University of Singapore, a grant from the National ... 40667–40670.33 Paltauf F, Kohlwein S & Henry SA (1992) Regulationand compartmentalization of lipid synthesis in yeast. In Molecular and Cellular Biology of the Yeast Saccharo-myces (Jones...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ