Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-speciﬁc binding of a protein doc

Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx

... epidermal growth factor receptor (EGFR) is com-posed of an extracellular ligand -binding domain, a transmembrane domain and an intracellular tyrosinekinase domain. The binding of a ligand to the ... treatment of intestinal epithe-lial cells with geﬁtinib results in a dramatic increase in apoptosis and activation of the intrinsic apoptoticpathway via trafﬁcking of activated Bax to the mito-chondria ... extracel-lular domain of the EGFR induces receptor dimeriza-tion, activation of the intracellular kinase domain and autophosphorylation of tyrosine residues within thecytoplasmic domain of...

Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-speciﬁc binding of a protein doc

... of the R3 pair bound to L1 and L2.Turning a gene into an active state from a state of inactivation often involves binding of a single activatormolecule to its site in a repressive chromatin structure[37]. ... proteins are the dominant determinantsfor nucleosome positioning and spacing. Several exam-ples of nucleosome positioning due to the binding of a transcription factor to the target site and ... Thus, the binding of proteins at singular sites in an array of densely packed and equally spaced nucleo-somes can cause substantial decondensation and rear-rangements in condensed chromatin regions,...

Tài liệu Báo cáo khoa học: The role in the substrate speciﬁcity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... Terra WR & Ferreira C(2001) Amino acid residues involved in substrate bind-ing and catalysis in an insect digestive b-glycosidase.Biochim Biophys Acta 1545, 41–52.21 Ferreira AHP, Marana ... bedeveloped to establish the contribution of each resi-due in the aglycone -binding site to the binding of diverse types of aglycones. Furthermore, these datamay be of particular importance in understanding ... M453 in aglycone binding The spatial structures of ZmGlu1, SbDhr1 and BglBrevealed groups of amino acid residues that formed the binding site of the substrate aglycone. These aglycone-binding...

Tài liệu Báo cáo khoa học: Caveolin-1 inﬂuences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx

... fromCaveolin-1 cDNA are GCAAGTGTACGACGCGCAC and AACCAGAAGGGACACACA, respectively.As negative controls (scrambled shRNAs), shRNAcontrol1(TAGCGACTAAACACATCAA), shRNAcontrol2(TATAGCGACTAAACACATCAA) and ... for Caveolin-1 and P2X7 of Caveolin-1 shRNA-treated E10 cellsrevealed a partial loss of colocalization of P2X7, with a remaining low amount of Caveolin-1 protein and analtered intracellular ... (amino acids 271–349) contains a Caveolin-1 -binding motif between amino acids 322 and 349. Deletion of this binding domain altered localiza-tion of TRPC1 to the plasma membrane. Ion channelsare...

Báo cáo khoa học: Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana ppt

... 5¢-ATCGACGGGCCTGACTCAT-3¢,5¢-CAACATTGAGCCCAGCAATAAC-3¢,5¢-CAGCTATTTAAGCCGTCTTTTCCA-3¢,5¢-GATAGATGCAGAGCCACCAAAGA-3¢,5¢-CGGACATGAGAGAGCAAAGTCA-3¢,5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢-ACCCGACGGTGGTGACTACA-3¢, were ... 5¢-VIC-CAGTACCTTCCAGCAGATGTGGATCGC-TAMRA-3¢,5¢-FAM-CCAGCTTACTTACTTCAATGATGCTCAAAGGC-TAMRA-3¢,5¢-FAM-CTATGCAAGGTCTCAGTCAGGCTCGGC-TAMRA-3¢,5¢-FAM-ATGCTAATGTGGCTCCAGTTTGCCTCT-TAMRA-3¢,5¢-FAM-TCCACTCTCTTTTGAGCCATCCAATGC-TAMRA-3¢,5¢-FAM-AACGACTTGCTTTTGCTCTTCTCTCGC-TAMRA-3¢ ... 5¢-ACGTCGCTGCAGCGATCTGATCACTGAGAAAC-3¢, and a reverse primer, 5¢-AAAGCCGGTACCCTCTGCTATTACAATGACGAAAACGATTATC-3¢, using mRNA from Arabidopsis plantlets treatedwith TM for 6 h. The obtained...

Báo cáo khoa học: N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide pptx

... that has not been found to date in bacterialpolysaccharides. Studies of binding of mAb 2625 to theN-methylated legionaminic acid derivatives is described in the accompanying paper [26].MATERIALS ... was applied to stereo-chemical analysis of the N-methylated acetimidoylamino(acetamidine) groups in 2 and 3, which may occur asstereoisomers due to a partial double-bond character of thelinkages ... revealedL-rhamnose,D-mannose, Kdo, and amino sugars, i.e. total hexosamine according to theMorgan±Elson reaction after acid hydrolysis (total of 2,3-diamino-2,3-dideoxy-D-glucose, 2-amino-2-deoxy-D-glucose,...

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... RNA-cleaving activity in a self-cleaving DNAzyme. The DNAzyme with DNA- cleaving and RNA-cleaving activities was constructedby incorporating the catalytic domain of 8–17 variantDNAzyme into the ... insightsinto the engineering of DNAzymes.Experimental proceduresMaterialsThe DNA sequences (PL DNAzyme, 5¢-GAATTCTAATACGACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢;8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCGGGCCTC-3¢; ... interference in the DNA- cleavingcatalytic domain of DRc DNAzyme. Reducing the RS to 6 bp increased the rate of DNA cleavage, whichapproached the self-cleaving rate of DRc DNAzyme in the absence of RS....

Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): molecular structure and interactions with HGFA inhibitor-1 (HAI-1) doc

... (KD2), a trans-membrane domain, and a cytoplasmic domain(Fig. 1A) . A human splice variant containing an extra16 amino acids inserted between KD1 and the LDLMolecular interactions of HGFA with inhibitor ... TheABCDFig. 1. Conformational states of the HGFA active site region. (A) Cartoon of HGFA and HAI-1 domain architectures. HGFA contains a heavychain (A- chain) disulﬁde-linked to the protease ... ﬁbronectin type Idomain, a second EGF-like domain, a kringle domain, and a C-terminal protease domain (Fig. 1A) . TheHGFA protease domain amino acid sequence has theKeywordscatalysis; hepatocyte...

Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by ﬂuorescence resonance energy transfer–ﬂuorescence lifetime imaging microscopy in living cells doc

... phPGK1–5aa–cerulean wereconstructed using the primers 5¢-CCGGA ATTCCAATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-GGCGGATCCA TAATA TTGCT GAGAG CATCC A- 3¢, and 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and ... the cytoplasmic area (in the case of cell samples with coexpression of GAPDH) of cells, and are expressed as mean ± standard deviation. n, number of cells examined. Protein combination a 1(%) ... and BamHI sites of pcerulean-C1 or pcitrine-C1.phGAPDH–7aa–citrine and phGAPDH–5aa–citrine weresimilarly constructed using the primers 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCGG-3¢ and 5¢-CGGAA...

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... mutualeffects in fusion proteins containing an intrinsicallydisordered and a globular protein Ilaria Sambi1, Pietro Gatti-Lafranconi1*, Sonia Longhi2 and Marina Lotti11 Dipartimento di ... an N-terminalhexahistidine tag was obtained by PCR using thepET2 1a ⁄ PNT-H6plasmid [30] as the template. The forwardprimer (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to ... M, Takeda M, Shirogane Y, Nakatsu Y,Nakamura T & Yanagi Y (2009) The matrix protein of measles virus regulates viral RNA synthesis and assembly by interacting with the nucleocapsid protein. J...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ