0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: The viral SV40 T antigen cooperates with dj2 to enhance hsc70 chaperone function docx

Tài liệu Báo cáo khoa học: The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AM1: Purification and properties docx

Tài liệu Báo cáo khoa học: The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AM1: Purification and properties docx

... revealed that the a-subunit harbours putativebinding motifs for the molybdopterin cofactor and at leastone iron–sulfur cluster. Sequence identity was highest to the catalytic subunits of the tungsten- ... amounts ofpurified FDH1 used for isolation of the pterin cofactor werenot sufficient to allow quantification or the identification of the exact nature of the molybdopterin cofactor. However, the ... was tested under anoxicconditions. To test the inhibitory effect of sodium azide, the enzyme was pre-equilibrated with 0.9 mMsodium azide for2 min at 30 °C, then the reaction was started with...
  • 9
  • 461
  • 0
Báo cáo khoa học: The guanine nucleotide exchange factor RasGRF1 directly binds microtubules via DHPH2-mediated interaction docx

Báo cáo khoa học: The guanine nucleotide exchange factor RasGRF1 directly binds microtubules via DHPH2-mediated interaction docx

... assay did not prevent the inhibitory effect ofstathmin on microtubule assembly (data not shown).Taken together, these results suggest that the DHPH2module does not affect in vitro microtubule dynamics.Colocalization ... the cytoskeleton, the former promoting the recruitment of elements of the Rac1 signaling pathway, and the latter regulatingRho activity [47–50]. However, investigating whether the association ... notdissociate RasGRFs from microtubules.These results indicate that neither motor proteinsnor MAPs mediate RasGRF interaction with micro-tubules and suggest that this association is very tight.The...
  • 12
  • 192
  • 0
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

... where the flux thro ugh the oxidative p entosephosphate pathway had to be reversed to maintain the target fluxes. Then, the NADPH needed to drive the reactions of the o xidative pathway into a ... minimum. The first part of this report brieflyoutlines the mathematical basis of the method. The secondpart presents two applications of the method to the metabolism of erythrocytes and of the microorganism,Metylobacterium ... methodpostulates that the most likely distribution of stationaryfluxes in the metabolic network has to be optimal with respect to a feasible optimization criterion. The definition of the optimization...
  • 18
  • 799
  • 0
Báo cáo khoa học: The association of viral proteins with host cell dynein components during virus infection pdf

Báo cáo khoa học: The association of viral proteins with host cell dynein components during virus infection pdf

... viruses towards the cellFig. 2. Viral retrograde transport model. Both the entry of the viral particle through the endosome pathway (A, C) and the direct fusion of the viral envelope to the plasma ... recent data seem to indicate that mutations in the DYNLL1 binding site within the P phosphoproteinof RV significantly attenuated viral transcription andreplication in the central nervous system, ... that virus association also occurs with the viral protein adopting an extended antiparallelb strand that fits into the DYNLL1 groove and extends the pre-existing b-sheet. The atomic coordinates...
  • 15
  • 314
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... readmitted patients were excluded from the analysis. During the study period no attempt was made to alter the daily routine strategy. The study protocol was approved by the local ethics committee.During ... ICUs.Most importantly, it is not clear whether obtaining daily routineCXRs truly alters the daily management of ICU patients. There-fore, we conducted the present study to determine the inci-dence ... management oftheir patients in the present study; instead, we observedwhether abnormalities on the CXRs led to a change in therapy.We believe that this is a more accurate way to determine the value...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... fusionBPPs that showed greater catalytic constants towardsInsP6than the original enzymes. It appears that the action of PhyH-DI is general, i.e. not limited to itsinteraction with PhyH-DII, ... efficiencies. This is the first report to elu-cidate the substrate specificity of the incomplete domain and the functionalrelationship of tandemly repeated domains in BPPs. We conjecture thatdual-domain ... andtetra-phosphorylated IPPs present in the environment[4,21]. Interestingly, the catalytic activity of PhyH ismuch greater than the activity sum of PhyH-DI andPhyH-DII and two times greater than that of...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... fused to the GAL4 DNA-bindingdomain or the empty vector pBD, with PTI1-1 or PTI1-4 fused to the activation domain or the empty vector pAD. (B) Yeast two-hybrid assays with PTI1-4 fused to the ... root extractsafter immunoprecipitation with the anti-MPK3 IgG(Fig. 6D). On the other hand, the MPK6 protein waspresent in root extracts after immunoprecipitation with the anti-MPK6 IgG. These ... syrin-gae pv tabaci expressing AvrPto [17]. On the otherhand, expression of the tomato SlPti1 cDNA in the rice Ospti1a mutant suppressed the mutant phenotype.These results indicate that PTI1 acts as...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... considering the great variability in CDE nucleo-tide sequences, and the fact that functional assays with just one mutant promoter could not pinpoint thissite exactly, we suggest that the site shifted ... Recently, the regulation of the BUB1B promoter was tested. The transcription factorhStaf ⁄ ZNF143 was found to be the main activator of the promoter. Furthermore, cell cycle-dependent regu-lation ... afurther decrease in regulation. The CDE alone was nottested [41]. The CDE mutation that was assayed wouldalso alter a putative CDE site with the standard dis-tance of four nucleotides to the...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... of the Bcl-2family involved in the initiation of apoptosis through the mitochondrial pathway. The key event in the mito-chondrial pathway is the release of proapoptotic fac-tors from the mitochondrial ... interacts with tBid, but not with Bid. Itch ubiqui-tylates tBid and promotes its proteasomal degradation.We then demonstrated that Itch has an antiapoptoticeffect in cells, apparently through the ... to allow tBid to interact with its partners[15]. Removal of the N-terminal portion also seems to be necessary to allow the interaction of tBid with Itch. The molecular basis of this interaction...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... PAI-2)SJS174 GCTCACTGCCTAAGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2)SJS175 CTTTATTAGCTACAAAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2)SJS259 CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 ... CCTCTTACACTTGCTTTTGAC Forward (nt 455–474 pTETBBB)SJS170 GCAAAGGTGCCTTTGAGGTTG Reverse (nt 897–878 pTETBBB)ALS030 GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH)SJS209 CTTGATTTTGGAGGGATCTC ... transcript. Furthermore,we also demonstrated that the 108 nucleotide AREwas sufficient to destabilize the b-globin transcript with kinetics similar to those seen with the PAI-2full-length 3¢ UTR.The...
  • 14
  • 635
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM