0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... kineticparameters Km, Vmax and kcatwere determined for thepurified AATB3. Values for Km and Vmaxfor bothamino donors (l -aspartate and l-glutamate) and ac-ceptors (a- ketoglutarate and oxaloacetate) ... L-glutamate.The activity of L -aspartate was adjusted to 100.b30 mML -aspartate was used as amino donor for a- ketoglutarate, and 30 mML-gluta-mate was used as amino donor for oxaloacetate. The activity ... aspartate aminotransferase and its complex with maleate.Biochemistry 38, 2413–2424.11 Kim H, Nakaoka M, Yagi M, Ashida H, Hamada K,Shibata H & Sawa Y (2003) Cloning, structural analysis and expression...
  • 13
  • 490
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

... equation.All reducing sugar assays included a glucose standardcurve. The average molecular mass of the XG oligosaccha-rides (XGOs) was calculated from the manufacturer’s data and was found ... Cloning, expression and characterization of a family-74xyloglucanase from Thermobifida fuscaDiana C. Irwin, Mark Cheng*, Bosong Xiang†, Jocelyn K. C. Rose‡ and David B. WilsonDepartment of ... glucose as a standard. Each data point represents the average of threeseparate digestions and the PAHBAH measurements foreach digestion were run in triplicate.Tomato cell walls were isolated as...
  • 9
  • 453
  • 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

... sulfate fraction; lane 4, recombinant NaoA afterSephadex G75 chromatography; lane 5, purified recombinant NaoAafter DEAE-Sepharose Fast Flow chromatography; lane 6, standardmolecular mass markers ... b-lactoglobulin A, pI 5.1; myoglobin, pI6.8/7.2; trypsinogen, pI 9.3. The pI of NaoA was determined from a standard curve of pI and migration distance (cm) of protein standards.Enzyme assay and analytical ... completeDNA fragment can catalyze the oxidation of nitroalkanes.In this paper, we describe the cloning and characterization of a novel gene (naoA) that encodes nitroalkane-oxidizingenzyme in S. ansochromogenes.MATERIALS...
  • 6
  • 255
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... 5¢-GGTTATCATATAAAGATCTCAAATTACCC-3¢, for the second PCRthe primers were: 5¢ primer, 5¢-GGGTAATTTGAGATCTTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGGGATCCTTAGTGATGGTGATGGTGATGGGTGACCGGTTTTTTGGTAGGTGAAC-3¢.ThethirdPCRwascarried ... proliferation assayWe next analyzed the ability of recombinant SSA tostimulate human T-cells. All SSA preparations yieldedFig. 1. SDS/PAGE and immunoblotting analysis of SSA. (A) 12.5%SDS/PAGE of ... of radio-activity was then measured using a Liquid ScintillationAnalyzer 1600 TR (Packard, Canberra, Australia). Allmeasurements were made in triplicate.Binding analysisThe interaction of...
  • 9
  • 485
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crabParatelphusa jacquemontiiMaghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya SuriyaDepartment ... sialidasetypeX,proteaseenzymes and molecular mass standards were purchased from Sigma.Preparation of crab seraFreshwater field crabs, Paratelphusa jacquemontii werecollected from the local ... Denmark.47. Kamiya, H. & Ogata, K. (1982) Hemagglutinins in the acornbarnacle Balanus (Megabalanus roseus): purification and char-acterization. Nippon Suisan Gokkaishi 48, 1427.48. Kamiya,...
  • 8
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B1).Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence()35 to )23, AAANNNTTATATA) ... catalyticsubunit of Hdr from methanogenic archaea have beendeposited in the databases. None of these putative pro teinshas b een c haracterized and no f unction has been assigned toany of...
  • 10
  • 564
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... bp wasproduced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAACAAACACAC-3¢, reverse primer: 5¢-AAGATGGTATTGAAGATGATGGTTGA-3¢), purified from agarose ... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGTCATGACCTCG-3¢. One strand of each oligonucleotide ... Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with32P using a Metaprime kit (Amer-sham Pharmacia Biotech Inc., Piscataway, NJ, USA). ForBAC DNA sequencing, the BAC clone was...
  • 16
  • 542
  • 0
Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

... Identification and characterization of a collagen-inducedplatelet aggregation inhibitor, triplatin, from salivaryglands of the assassin bug, Triatoma infestansAkihiro Morita1, Haruhiko Isawa2, ... Western blot analysis of triplatin-1 and -2 from the salivarygland of T. infestans. Extracts from a pair of salivary glands, recom-binant triplatin-1 and recombinant triplatin-2 were separated by15% ... clonesSalivary glands of T. infestans were dissected from thoraces of unfed adults, and poly A( +) RNA was isolated from 30pairs of salivary glands using a MicroPrep mRNA isolationkit (Amersham Pharmacia...
  • 8
  • 408
  • 0
Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

Báo cáo khoa học: Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis doc

... T A P T A K P R L R G 241-AATAAGCCTTGAATCAATGATGTTCTATTTTTTATAGCGTCCCGATGGCGGTGATGTTGT -N K P * 301-AGGCTGGAAGCAAATAAAAATACGAAGAGTGACTTCAAAAAAAAAAAAAAAAAAAAAAAA A 1-GCTTTGACGGCAATGAAGCACTTCGTAATTTTGATTCTTGCTGTTGTGGCCAGTGCCGTG ... R241-CAAAATCAGGATTGAATCAATGGTGTTCTAGATTTCTATAACCTACCGACGGCGGCAATT Q N Q D *301-TTGTGGGGTCCAAACAAATAAAACTACAAAGTGGGACCTCAAAAAAAAAAAAAAAAAAAABMadanin-1 MKHFAILILAVVASAVVMAYPERDSAKEGNQEQERALHVKVQKRTDG-DADYDEYEEDGTMadanin-2 ... E Q E R A 121-CTGCATGTAAAGGTACAAAAACGTACTGATGGTGATGCTGACTACGATGAATATGAGGAA -L H V K V Q K R T D G D A D Y D E Y E E 181-GATGGGACGACTCCTACTCCGGATCCAACTGCACCAACTGCTAAACCACGGCTTCGAGGA -D G T...
  • 9
  • 337
  • 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... compo-nents of each reaction mixture, after their chromatographicseparation and purification, were submitted to1HNMR(nuclear magnetic resonance) and FABMS (fast atombombardment mass spectrum) analyses ... Theconcentration of both the assayed compound and itsrespective transformation product was determined bycomparison of peak data with those obtained from authentic standards chromatographed at different ... S-Adenosyl-L-methionine:flavonoid 4¢-O-methyltransferase crude activity in healthy and inoculated tissues of the carnation cultivar ¢Novada¢.In each row, values followed by a same number of * are not statistically...
  • 10
  • 624
  • 0

Xem thêm

Từ khóa: cloning expression and characterization of oxysterol binding protein homologue 7 osh7 in yeast saccharomyces cerevisiaecloning expression and purification of a thaliana ttlcloning expression and purification of a fragment of the p murina msgbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ