Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated...
- 8
- 522
- 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... mixtures, a dramatic advantage of the top-down approach isthat a final separation stage can be done in the FT MS instrument. For example, after rough separa-tion of the proteins from Arabidopsis thaliana, ... covalent modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, orno change, the value had unexpectedly decreased from22 ... 4 Da, the decrease of the molecular mass value. The most proba-ble reason for a 2 Da decrease is the formation of anS–S bond; although this was totally unexpected andunprecedented, the top-down...
- 13
- 572
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... respectively, as a direct electron acceptor. The animal and plant l-gul-onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate.Only scarce data are available on the ... immediatelyupstream of the start codon (ATG). Primers with the fol-lowing sequences were synthesized by Proligo (Paris,France): 5forGulox (forward), 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The PCR product was cloned into the pDONR201vector, and the resulting plasmid,...
- 11
- 571
- 0
Tài liệu Báo cáo khoa học: "Man* vs. Machine: A Case Study in Base Noun Phrase Learning" pdf
... deciding whether it is part of a phrase or not. The rule actions we allow are: 2 Add Add a base NP (bracket a se- quence of words as a base NP) Kill Delete a base NP (remove a pair of parentheses) ... counted the number of times it appeared in the training set and the recall achieved on the test set. The plot of the test set recall vs. the number of appearances in the training set of each tag ... number of rules in the final rule lists also varied, from as few as 16 rules to as many as 61 rules, with an average of 35.6 rules. Again, the average number for the top three subjects was a little...
- 8
- 498
- 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
... 2P analog, rather than to a marked distortion of the DNA conformation.Determination of concentration of active form of M.EcoRIIIt is known that the concentration of the active form of DNA methyltransferases ... of a fluorine atom to the C5 position of the target cytosine results in an irreversible covalent attack of a cysteine residue and transfer of a methyl group to the C5 position of the target base ... can suggest that the potency of 2-pyrimidinone as an inhibitor arises from the retardation of proton elimination from the covalent intermediate in the course of catalysis as a consequence of the...
- 9
- 437
- 0
Báo cáo khoa học: "Simple English Wikipedia: A New Text Simplification Task" pdf
... require manual annotation.666For each aligned paragraph pair (i.e. a simpleparagraph and one or more normal paragraphs), wethen used a dynamic programming approach to findthat best global sentence ... that over a quarter of the sentence pairs in the data set are identical) the phrase-based approach does obtain a statistically significant improvement. To understand the the limits of the phrase-basedmodel ... paired the articlesby title, then removed all article pairs where eitherarticle: contained only a single line, was flagged as a stub, was flagged as a disambiguation page or was a meta-page about...
- 5
- 362
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... in analysis and synthesis. It also explains the gap in semantics and logical meaning, and gives a clear computaional image of what we call conceptual analysis. This grammar is used for analysis ... Kawasaki-city,213 JAPAN and Yasutomo FUKUMOCHI Softwear development devision NSIS Corporation Kawasaki-city,213 JAPAN ABSTRACT This paper describes some operational aspects of a language ... FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE. The case grammar, as a basis of internal representation, which is constructed with the combination of binary...
- 7
- 373
- 0
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... that was found for the wild-type enzyme. Although some activity wasmeasurable, it was clear that the microenvironmentaround the isoalloxazine moiety of the FAD analogcofactor was dramatically ... MAO A [158] – Animal AMO 2BXRMAO B [159] – Animal AMO 1GOSAmadoriase I [54] – Fungus DAAO 3DJDMSOX [36] – Bacteria DAAO 2GB0Pipecolate oxidase [36] – Animal DAAO –N-methyltryptophan oxidase ... it has beenshown that the covalent bond is necessary to raise the redox potential to a value that facilitates proper cataly-sis. On the other hand, there are also examples of proteins that normally...
- 23
- 564
- 0
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx
... allows the formation of macro-lactones instead of the native macrothiolactones. Several thiocoralineanalogs were isolated and investigated for DNA-bisintercalation activity.Relaxed substrate ... investi-gated substrates in graphical form in Fig. S 5A C.DNA-bisintercalation activity assay To evaluate the DNA-bisintercalative properties of chemoenzymatically generated thiocoraline analogsand to ... macrocyclization platform that iscapable of catalyzing macrolactonization and a so farunreported macrothiolactonization.Initially, TioS T-TE was tested using a linear tetra-peptide based on the amino...
- 13
- 466
- 0
Báo cáo khoa học: Bacterial IscU is a well folded and functional single domain protein pdf
... occurring. Inall datasets, the absorbance of the depleted area at a finalspeed of 40 000 r.p.m. provided an experimental value for the baseline offset. The data were analysed with the ORIGINXL- A /XL1 ... mM2-mercaptoethanol. Lower panel: Experimental absorbance at 280 nmas a function of the radial position and data fitting to the equationreported in Materials and methods. Upper panel: Distribution of ... 109 amide resonances as a function of the relaxationdelay and the data were then fitted by least-squares fitting to a single exponential. Correlation times were calculatedfrom the T1/T2ratios...
- 8
- 303
- 0
Từ khóa: a new approach to the problema new approach to the maximum flow problema new approach to the shaded picture problema new approach to the giant component problema new approach to the surface intersection problema new approach to the conjugacy problem in garside groupsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ