Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identiﬁes a calcium sensitive region required for basal activity doc

... a õ et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required ... 5¢-CGGGATCCCAATCTGTTGCTAATTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GAAGATCTACCACACCTCCTCATCTCC-3¢) for ampli-fication of the region from )180 to )36 and (5¢-GAAGATCTAACTAGATTTTACCATTGG-3¢) for amplification of the region ... present the molecular organization of the first nonmammalian M GP gene and the functional analysis of its promoter. We identified a region within the first 70 bp of the xMGP promoter that mediates transcriptionalactivation...

Báo cáo khoa học: Molecular cloning, expression analysis and functional conﬁrmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... GGTGATATAGGCTTGACTCCGTTGA LdUSP-RR1 GGCATCTGTTTCTTTGTCGCTTGTCLdEcR-RR2 ACACACTCTGCCCTCATTCCTACGG LdUSP-RR2 CTCCCGGCAAGCGTAAGACAAATC3¢-RACELdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAGLdEcR-RF2 ... body(WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larvalinstar, and in the adult male WB (#), femaleWB ($), testis TES and ovary (OVA), andL. decemlineata ... moiety of dibenzoylhydrazines onlarvicidal activity against the Colorado potato beetleLeptinotarsa decemlineata. Pest Manag Sci 57,858–865.56 Nakagawa Y, Minakuchi C, Takahashi K & Ueno...

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

... doi:10.1046/j.1432-1033.2003.03878.xreaction (RT-PCR) and RACE-PCR. Marathon-ReadyTMhuman adrenal gland and fetal brain cDNA libraries werepurchased from Clontech (Palo Alto, CA, USA). The RACE-PCR was performed according to the ... shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio, and the sample size percRNA combination is shown in parenthesis. Data are from ﬁve diﬀerent batches of oocytes, each ... MW.Custom-made software and hardware were used for acquisition and analysis of data. Leakage and linear capacity currents weresubtracted by using P/4 protocols. Data were sampled onceevery 5 ls and...

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... stomach total RNA sam-ples of three animals in the unrelated dsRNA treated group. The arrow denotes the size of the signal obtained only in stomach totalRNA pool from the control animals. A BFig. ... Phar-macia) according to the instructions of the manufacturer.Northern blot analysis Northern blot analysis was used to characterize the expres-sion of the shrimp CHH gene. Ten micrograms of ... subesophagic ganglion of Homarus americanus[15,16]. It is also detected in the retina of the crayﬁshProcambarus clarkii [17]. The cloning and molecular characterization of CHHfamily peptides have been...

Báo cáo khoa học: Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae pot

... GCATTCCGACACTGAGGCACTTTT RR2 AGCCTTTACAACCTTCACAGCPrimers for 3¢-RACE RF1 GAAAAAGTGCCTCAGTGTCGGAATG RF1 ATAGCTGTGAAGGTTGTAAAGGRF2 CAGTGTGCCATCAAACGGGAGTCTA RF2 GACAAACGTCAAAGGAATCG a N means a mixture of ... CATCATNACYTCNSWNSWNSWNGC R2 CAYTTYTGRTANCKRCARTAR3 AAYTCNACDATNARYTGNACNGT R3 GCAAGCTGGAAAAGAGTAATGTGACPriners for 5¢-RACE RR1 AGACTCCCGTTTGATGGCACACTG RR1 ATACTGGCAGCGATTCCTTTGACRR2 GCATTCCGACACTGAGGCACTTTT ... WSNGGNTAYCAYTAYAAYGC F1 ATHTGYGGNGAYMGNGCF2 GARGGNTGYAARGGNTTYTT F2 GGNAARCAYTAYGGNGTNTAF3 TGMGNMGNAARTGYCARGARTG F3 GATTCAGATCCCGACCATAAAGAR1 TCNSWRAADATNRCNAYNGC R1 TCYTCYTGNACNGCYTCR2 CATCATNACYTCNSWNSWNSWNGC...

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... mammalsand can acts on the a- andb-sites of the mammaliansodium channel [44]. Therefore, whether Tyr31 is relatedTable 2. The amounts of aconitine required to induce arrhythmia inuntreated rats ... bp,respectively. A single AATAAA polyadenylation signal wasfound 11 nt upstream of the poly (A) tail. There was onlyone stop codon (TAA) at the 3¢ terminus of the ORF. The cDNA sequence has been submitted ... tryptamine/4M-toluene-p-sulfonic acid at 110 °Cfor24 h. Analysis of this preparation was completed using a 121-MB Beckman amino acid analyzer. An Applied Bio-systems 47 6A sequencer was used for automated Edmandegradation....

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... with a Thermal Cycler Dice RealTime System (TaKaRa Bio Inc.). Forward primers 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse ... reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-CATGG-3¢ were used for detecting GmPDIL- 3a andGmPDIL-3b, respectively. Primers for quantiﬁcation of actin mRNA were as described ... 3a or 3b. Activity was assayed by measuring the RNase activity produced through the regeneration of the active form of reduced RNase A. Data represent the mean ± standard deviation for three...

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene (GenBank accession numbersBE590673 and ... puriﬁcation of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) oligo-nucleotide primers having an initiation ... Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-ments containing a complete x-5 gliadin gene, oligonucleo-tides,...

Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulﬁde isomerase from Conus marmoreus pdf

... isomerase activity of PDI [23]. The lag time before appearance of the active RNase A indicates the oxidase activity, which corresponds to the x-intercept of the RNase activity plot. The oxidase activity matches ... reaction times, the refoldingmixture was acidiﬁed and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated from their elution peakareas. The data are the average ... polypeptides. For example, the C-terminal Gly that is used for amidation of the mature form of x-conotoxin containing an ami-dated C-terminus, as isolated from the venom of Conusmagnus (x-MVIIA) can signiﬁcantly...

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulﬁde isomerases as molecular chaperones for seed storage proteins doc

... 5¢-GTCTGTGGTACCTCCTTCAAAACCCCCTCCT-3¢ and 5¢-CGTGATGGTACCGGGTGTGCAACCCACATGTA-3¢ for GmPDIL-1, and 5¢-CAGCCCGCAGTTGAAAGTCAACCAAGTC-3¢ and Oligo dT-Adaptor primer FB (TaKaRa Bio Inc.) for GmPDIL-2.Amplicons ... ampliﬁed from cDNAs of GmPDIL-1 and GmPDIL-2 by PCR using the oligonucleotide primers 5¢-GACGACGACAAGATGGAGGAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGAAGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ for GmPDIL-1, and ... Activity was assayed by the measurement of RNase activity produced through the regeneration of the active form of reduced RNaseA. Data represent the mean ± SD for four experiments. The data for...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ