Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... label of the parent and of ancestors with
a different category, as in the case of VP/S-NOM in
the example.
2.1 Task representation and evaluation method
To formulate the task as a machine-learnable ... Shallow parsing on the basis of words only: A case study
Antal van den Bosch and Sabine Buchholz
ILK / Computational Linguistics and AI
Tilburg University...
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... whereas that for melibiose
and a- Me-Gal, as anomers of lactose and b-Me-Gal,
was in the intermediate exchange regime. Thus, the
configuration at the hemiacetal carbon of galactose
may affect the ... Cross-peaks are labeled based on an
analysis of through-bond connectivities. The
side chains of NH
2
resonances of aspara-
gines and glutamines are connected by
horizontal l...
Báo cáo khoa học: "Corpus Effects on the Evaluation of Automated Transliteration Systems" docx
... held at least a Bachelors de-
gree. Table 1 summarizes the information about
the transliterators and their perception of the given
task. Participants were asked to scale the difficulty
of the transliteration ... Persian translit-
eration systems on a variety of controlled corpora
using evaluation metrics that appear in previous
transliteration studies. Varying the evalu...
Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf
... Corporation
Research on a non-statistical scheme for the insertion of English articles
in machine-translated Russian is described. Ideal article insertion as a
goal is challenged as unreasonable. ... considerations, or use a combined syntactico-
statistical method; the aim of all such routines is the
selection of one and only one of the four articles (a,
an, the...
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... 2 in the mito-
chondrial membranes of all of the deletion mutants suggest
that these can be assembled as a subcomplex in the mito-
chondrial membrane, independent of the presence of any
other ... Electro-
phoretic analysis of DNA on agarose gels, restriction
endonuclease analysis, ligation of DNA fragments,
Table 1. Yeast strains used in this study.
Strain Genotype Ref...
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... Ca
2+
-dependent
manner almost as effectively as intact Akazara scallop troponin. Therefore,
Akazara scallop troponin regulates the contraction through the activating
mechanisms that involve the region spanning ... in the absence of divalent cation. Therefore,
this interaction potentially participates in both the
Ca
2+
-dependent activation of the contraction and the
mainten...
Báo cáo khoa học: "An experiment on the upper bound of interjudge agreement: the case of tagging" docx
... descriptive grammar by Quirk
et al. (1985), also that work was made available
to them, as well as a number of modern English
dictionaries.
The training was based on the disambiguation
of ten smallish ... patents ('Pat');
one contained excerpts from the law of Cali-
fornia; one was a medical text ('Med'). None
of them had been used in the developm...
Báo cáo khoa học: "Incremental Parsing with the Perceptron Algorithm" potx
... the parser will depend on
the definition of partial analyses, of ADV and FILTER,
and of the representation Φ. The next section describes
our instantiation of these choices.
3 A full description ... incorporated into a partial analysis for
the previous words. For any partial analysis there will
be a set of potential attachment sites: in the example, the
attachme...
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
3′ 5′ 3′ 5′ 5′3′
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
ACAAUGUGAAA
GCAAUGUGAUA
5′
3′
UAAAUGUGAAU
ACUAAGAGUAA
GCAAUGUGAUA
IL6R mRNA mut 1
... in about
252 1A
BC
5′
3′ 5′ 3′ 5′ 5′3′
3′
UAUAAGAGUAU
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
3′ 5′ 3′ 5′ 5′3′
CCUU...
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: pectenotoxins, unusual macrolides that disrupt actin pptx
... chemotherapy agents and actin cytoskeleton dynamics with potential
clinical applications.
Abbreviations
F-actin, filamentous actin; G-actin, globular actin; OA, okadaic acid; PTX, pectenotoxin; SA, ... nucle-
ation. On the basis of models of the actin filament,
PTX binding would disrupt key lateral contacts
between the PTX-bound actin monomer and the lower
lateral actin monomer...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật