Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis Kasem Asawatreratanakul1,2, Yuan-Wei Zhang1,*, Dhirayos Wititsuwannakul3, Rapepun Wititsuwannakul4,Seiji ... temperaturecontrol of 30 s at 95 °C, 30 s at 50 °C and 1 min at 72 °Cwith a 5 min preheat at 95 °C and a 10 min final extensionat 72 °C using primers, S1 (5¢-GCAAATGCAACTGGAAGCGG-3¢)andA1(5¢-ACAGCCTGCTAGCAAAGAGG-3¢) ... (5¢-GCAAATGCAACTGGAAGCGG-3¢)andA1(5¢-ACAGCCTGCTAGCAAAGAGG-3¢) for amplification of HRT1, and primers S2(5¢-GAAGAATCCTCTAAGGATAA-3¢)andA2(5¢-TACAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. The PCR products were analyzed by agarose gelelectrophoresis...
- 10
- 516
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... recorded against a reference cuvette con-taining NADPH, EDTA and buffer only. Subsequently,insulin was added, and a stable nonenzymatic rate wasrecorded. Finally, PDI was added, and the total NADPHoxidation ... refoldingmixture was acidified and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated from their elution peakareas. The data are the average of three independent ... calculated molecular mass of 54 913.7 Da and an isoelectric point of 4.6. The cPDIcontains four thioredoxin domains and an acidic C-ter-minal tail (a, b, b¢, a and c). Two thioredoxin activesites...
- 10
- 405
- 0
Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf
... 480Cc-CATH1 actgtcccctcgctgccttccatccaataaaggtctttgctggtaaaaaaaaaaaaaaaa 531Cc-CATH2 TTG-CTGAg-gaataaa-ggggc gtgtg c-accaagc -a 517Cc-CATH3 g tc a cc c aataaa-c-g ttca-gct 540C c- CATH 1 aa a a ... 60Cc-CATH3 60Cc-CATH1 CCCCTGGATTACAACCAGGCTCTGGCCCAGGCTGTGGACTCCTACAACCAACGGCCCGAG 120Cc-CATH2 T AGC CC G AT A 120Cc-CATH3 C 120Cc-CATH1 GTGCAGAATGCCTTCAGGCTGCTCAGCGCCGACCCCGAACCCGGCCCAAACGTCCAGCTC ... GCCGGTGGC AC G GC G 420Cc-CATH1 GGATACAACCTCTACCGGGCAATCAAGAGGAAGTGAgccgtccccagagctgctgtcacc 471Cc-CATH2 T AGA-GGTC-G GCTT TC-CTA TCA-C-T-GCCG T-G CA-G-T 457Cc-CATH3 CAT AAA C G ATGA acg-t c...
- 12
- 406
- 0
Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt
... 90 GAG GCC ACC AAT gtgagtagga 614 tatttaacag TCT AGT TCT Asn125 (3)5 175 CGT ATC CAG G gtgagtctgt 226 ccccacacag CT CAG CTG TCC Ala184 (1)6 131 AAA TAC CGA CTG gtaaacccaa 79 atgataccag GAC CTG ... 143 AAC AAA GCA G gtatattcag 434 atgtttccag GT GAG AGA ATG Gly640 (1)16 156 CCG CCC CTT T gtaagcaacc 139 tcacctaaag CC AAA GCA GTG Ser693 (1)17 52 GTC GTG CCA GA gtaagtgaca 368 ccgtgcacag G ... proteins are also found in TfSTAT5, including anN-terminal protein interaction domain, coiled-coil domain,DNA-binding domain, SH2 domain, and C-terminaltransactivation domain. Furthermore, a...
- 14
- 456
- 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf
... body(WB) at day 4 in the last larval instar, in theINT at day 0, 2, 4, 6 and 8 in the last larvalinstar, and in the adult male WB (#), femaleWB ($), testis TES and ovary (OVA), and L. decemlineata ... CTCCCGGCAAGCGTAAGACAAATC3¢-RACELdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAGLdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCCT. Ogura et al. Molting ... spatial expression pattern of EcR mRNA wasanalyzed using total RNA prepared from the fat body,gut, integument and whole body of L. decemlineatalarvae at day 4 of the last (4th) instar. A 12.4-kb...
- 15
- 564
- 0
Báo cáo khoa học: Neuropeptide Y expression and function during osteoblast differentiation – insights from transthyretin knockout mice potx
... 5¢-GTAATGATCAGTCAACGGGGGAC-3¢ and 5¢-CCAGCAAGCTTGCAACCTTAACCA-3¢; for GAPDH, 5¢-ACTCCACTCACGGCAAATTC-3¢ and 5¢-CCTTCCACAATGCCAAAGTT-3¢; for NPY, 5¢-TGGACTGACCCTCGCTCTAT-3¢ and 5¢-GATGAGGGTGGAAACTTGGA-3¢; ... 5¢-CCTGGGGTCACACCTAAAGA-3¢ and 5¢-TGTAAGGACACACCGGAACA-3¢; for Y1 receptor, 5¢-CTCGCTGGTTCTCATCGCTGTGGAACGG-3¢ and 5¢-GCGAATGTATATCTTGAAGTAG-3¢ [15]; for Y2 receptor, 5¢-TCCTGGATTCCTCATCTGAG-3¢ and ... Takahashi T, Kamiya N, Kawabata N & Takagi M(2008) The effect of retinoic acid on a zinc fingertranscription factor, AJ18, during differentiation of a rat clonal preosteoblastic cell line,...
- 13
- 413
- 1
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx
... uences.Primername Sequence21 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA33 CCGGAATTCTTATTTCCCTTCTCTCATCTC40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 GGGGGGGATCCT CATTATTTCCCTTCT66 ... AATACCGCCATGTATAATATCTATTACTTC67 GTAATAGATATTATACATGGCGGTATTGAA75 GGGGGGGCCATGGAAAGAGCAGACGATTT4294 H P. Chen et al.(Eur. J. Biochem. 271) Ó FEBS 2004assay k it was obtained f rom B io-Rad, ... forD-ornithine aminomutase to maintain anactive conformation.Keywords: adenosylcobalamin; B12;D-ornithine amino-mutase.D-Ornithine aminomutase from Clostridium sticklandiicatalyzes the...
- 5
- 401
- 0
Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx
... proteins carrying a functionalFLAG epitope from an excess of FLAG-negative com-petitors and from a large library of random variantswas also undertaken by plasmid display, to confirmthe efficacy of ... comparing the far-UV and near-UV CDspectra of PRAI and FLAG-PRAI in a buffer in which PRAI retains catalytic activity (Fig. 3). Thespectra are effectively superimposable in both cases.The far-UV ... of trPRAI-HisThe far-UV and near-UV CD spectra of trPRAI-Hiswere recorded and analyzed in a manner identical withthose for PRAI and FLAG-PRAI (vide supra). In addi-tion, the thermal melting...
- 14
- 382
- 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... frag-ments containing a complete x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA ... Foster City, CA, USA). Expression and purification of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... Isoplant DNA extraction Kit (Takara Bio Inc.,Shiga, Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA...
- 8
- 484
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... MW.Custom-made software and hardware were used for acquisition and analysis of data. Leakage and linear capacity currents weresubtracted by using P/4 protocols. Data were sampled onceevery 5 ls and ... from cDNA libraries of adrenal gland, brain and fetal brain.BLASTsearches of the human genomic sequence with the cDNA encoding the rat b 1A subunit C terminus alsofailed to identify any homologous ... of NaV1.2. Each individual data point in the histogram represents the peakinward current for a single oocyte. Also shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio,...
- 9
- 415
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP