Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... nativesignal peptide was ampliﬁed by PCR using the followingprimers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... W81, as observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand ... melanogasterejaculatory bulb [30], Mamestra brassicae proboscis [17],labial palps of the moth Cactoblastis cactorum [14] and cellsunderlying the cuticle in Phasmatodea and Orthoptera [31].Although...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... alternative pathways are avail-able, it is unlikely to play any signiﬁcant role in the catabolism of the branched-chain amino acids or of methionine.Identiﬁcation and mutation of residues affectingsubstrate ... on the decarboxylation of 2-ketopentanoic acid.Each variant has a Kmvalue less than 1 mm, which islower than that of the wild-type enzyme, as well askcat⁄ Kmvalues that are greater than...

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

... control waspurchased from Silenius (Hawthorn, Australia) and poly-clonal goat anti-GST antibodies from Pharmacia BiotechInc. The goat antihuman IgG speciﬁc antibody wasobtained from Sigma and the ... domain GSTfusion proteins migrated as major bands of  50 kDa. AfterFactor X or thrombin cleavage and removal of GST the I domains appeared as single major bands of approximately24 kDa (CD1 1a) ... I domain of CD1 1a, andpartially but signiﬁcantly inhibited the interactionbetween ICAM-4 L cells and CD1 1a I domain. The adhesion of all ICAM transfectants to the I domain of CD1 1a was almost...

Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt

... VAO and the bacterial hydroxylases is the mode of binding of the FAD cofactor. In VAO, FADis covalently bound to a histidine, whereas the bacter-ial counterparts contain a tyrosyl-linked FAD ... covalent attachment of the FAD cofactor. The successful in vitro cofactor incorporation showsthat the covalent incorporation is an autocatalytic pro-cess. Covalent flavinylation is postulated ... agreementwith the observation that the ratio of protein ⁄ flavinabsorbance increased after incubation with excessFAD. The A 280⁄ A 441ratio of EUGO, as purified, was12.5, whereas incubation with FAD...

Báo cáo khoa học: Study of synthetic peptides derived from the PKI55 ppt

... Rul-fo per la Genetica Medica, Parma, Italy; and the Fondazione Cassa di Risparmio di Ferrara, Italy. Weare grateful to Banca del Sangue of Ferrara for pro-viding fresh blood and Dr Amanda Neville ... essen-tial for a detailed understanding of the signaltransduction pathway, and should lead to the develop-ment of new drugs [16].PKC is an attractive candidate as a therapeutictarget, but clinically ... for-Met-Leu-Phe-OHRita Selvatici1, So a Falzarano1, Lara Franceschetti2, Adriano Mollica3, Remo Guerrini4,Anna Siniscalchi5and Susanna Spisani21 Dipartimento di Medicina Sperimentale e Diagnostica,...

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... further enhances FC-stimulatedH+-ATPase activity [22].Here we report a characterization of the interaction of PPI1 with the H+-ATPase in PM isolated from control and FC-treated A. thaliana ... with antisera against the N-terminus of PPI1 (A) or the C-terminus of the H+-ATPase (B).His6–ACA8(1–116) reproduces the N-terminus of an A. thaliana PMCa2+-ATPase [31]. Results are from...

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, HirataM, Mazda O, Katsura Y & Narumiya S (1993)Thromboxane A2 receptor is highly expressed in mouseimmature thymocytes and mediates DNA fragmentationand apoptosis. ... Grazia U, Felli MP, Vacca A, Farina AR, Maroder M,Cappabianca L, Meco D, Farina M, Screpanti I, Frati Let al. (1994) Positive and negative regulation of the com-posite octamer motif of the ... alpha and beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of the 5¢ untranslated region of alpha and betaisoforms of the...

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... 3-OH-c-car-otene and lycopene. The values represent ratios of the C17and C19dialdehydes in the sum of their peak areas calculated by integratingeach peak at its individual kmax. Data represent ... citral, the mixture of geranial and its cis-isomer neral, is a major component of the aroma of lemon grass and other lemon-scentedplants. Geranial is synthesized from geranyl diphos-phate by the ... Ibdah M, Azulay Y, Portnoy V, Wasserman B, Bar E,Meir A, Burger Y, Hirschberg J, Schaffer AA, Katzir Net al. (2006) Functional characterization of CmCCD1, a carotenoid cleavage dioxygenase from...

Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... GATCATGCACTGAAATTTA (2), GATGAAACCTCTCAAACTG (3), and CATCATCGCTGGACAATGT (4)], usingT. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1CFEBS Journal 274 (2007) 4812–4824 ª 2007 The ... Dunkern and A. Hatzelmann Characterization of inhibitors of phosphodiesterase 1C on a human cellular systemTorsten R. Dunkern and Armin HatzelmannBiochemistry 2 Inﬂammation, ALTANA Pharma AG, Member ... lL of a substrate solution (Promega, Madison, WI,USA; CytoTox96 assay), and after 15 min of incubation,an additional 50 lL of a stop solution. Thereafter, extinctionwas measured at a wavelength...

Xem thêm