Báo cáo khóa học: SUT2 is a novel multicopy suppressor of lo

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-bind- ing motif in the N-terminal of the protein sequence and ... is the His residue that in NirS is the proximal axial ligand to the d 1 heme. Replacement of an equivalent His, His41, in NirF by Ala abolished bind...

Ngày tải lên : 15/02/2014, 01:20

12
613
0

Tài liệu Báo cáo khoa học: Bacitracin is not a speciﬁc inhibitor of protein disulﬁde isomerase pptx

... able to catalyze the reduction of disulﬁde bonds. The effects of bacitracin on this activity were examined using the insulin precipitation assay. In the noncatalyzed assay, the disulﬁdes of insulin ... Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI. Both the PDI a domain and DsbA have a catalytic site, with an associated subst...

Ngày tải lên : 16/02/2014, 14:20

9
620
0

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of the vacuolar hydrolases ... chain fatty acids, in a- oxidation, bile acid and ether lipid synthe- sis, and in amino acid and purine metabolism [1]. Peroxisomes are a source of reactive oxygen...

Ngày tải lên : 07/03/2014, 05:20

11
568
0

Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx

... DAPs (death - associated proteins), that differ substantially in their biochemical properties and intracellular localization. DAP-kinases (DAPk), Ca 2+ ⁄ calmodulin-regulated and Ser ⁄Thr kinases, ... by Aaron Ciechanover (Haifa, Israel), who argued that the ubiquitin proteolytic system covers the pathway for elucidating the basic mechanisms that are pivotal for drug targeting. Degr...

Ngày tải lên : 19/02/2014, 02:20

4
510
0

Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf

... experiments, increasing amounts (5, 10, 50, 100 and 200-fold excess) of unlabeled visfatin–PPREwt (5¢-CAAT AC AGGGCAAAGATCATGGAAG-3¢) or visfatin–PPRE- mut (5¢-CAATAC AGGAAAAAGAAAATGGAAG-3¢) oli- gonucleotides ... increases the intracellular NAD + concentration in human macrophages As visfatin is known as a nicotinamide phosphoribosyl transferase [2], we investigated whether the i...

Ngày tải lên : 06/03/2014, 22:21

13
565
0

Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx

... acid disodium salt (AMS) were purchased from Invitrogen (Carlsbad, CA, USA). Antise- rum against in uenza haemagglutinin (HA) was obtained from Sigma (St Louis, MO). The other antisera used were from ... 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ (reverse). The EcoRI ⁄ BamHI-digested PCR fragm...

Ngày tải lên : 07/03/2014, 02:20

9
466
0

Báo cáo khoa học: Gene expression silencing with ‘speciﬁc’ small interfering RNA goes beyond speciﬁcity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

... (forward, 5¢-GGCCCAG GTGACTCAGCTATT-3¢; reverse, 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; ... samples. The presence of the internal standard probes at different locations of the array allowed quantiﬁcation of the local background and evaluation of the a...

Ngày tải lên : 07/03/2014, 05:20

16
494
0

Báo cáo khoa học: An acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata pot

... [20–23]. As in the case of S. baicalensis CHS, Hu. serrata PKS1 also accepted a variety of aromatic and aliphatic CoAs as starter substrates, and produced aromatic tetraketides after three condensations ... 1079 cDNA cloning The Hu. serrata plant used in this study was obtained from L Hua (Zhejiang Academy of Medical Sciences, Hangzhou, China). Total RNA was extracted from you...

Ngày tải lên : 07/03/2014, 10:20

10
369
0

Tài liệu Báo cáo khoa học: Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability transition pdf

... characterized and the most prominent pathways are the extrinsic and intrinsic pathways. In the intrinsic pathway (also known as the ‘mitochondrial pathway ), apoptosis results from an intracellular ... effect of HSS against CCCP-induced apoptosis, the activation of caspase-3 was examined using the enzymatic Caspase-Glo 3 ⁄ 7 assay. After CCCP treat- ment, caspase-3 act...

Ngày tải lên : 16/02/2014, 09:20

13
565
0

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... 5¢-GGAGATCTCCAGTGA TATCGACCA-3¢ and 5¢-ACGGCTTCTACGGATCGAA ACT-3¢ for PPARc ,5¢-AAGACAGCTCCTCCTCGAAGG TT-3¢ and 5¢-TGACCAAATCCCCATTTACGC-3¢ for aP2, 5¢-ATCCATGGATGGACGGTAACG-3¢ and 5¢-CTGGA TCCCAATACTTCGACCA-3¢ ... University, Japan 4 Laboratory of Biodefense and Regulation, Osaka University of Pharmaceutical Sciences, Japan Introduction The amount of adipose tissue in the body i...

Ngày tải lên : 16/02/2014, 09:20

10
647
0

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx