... Hydrodynamic analyses of MutS aggregates
A single mismatch in the DNA induces enhanced
aggregation of MutS
Hydrodynamic analyses of the protein -DNA complexes
Nabanita Nag
1
, G. Krishnamoorthy
1
and Basuthkar ... underline).
Name Size (nt) Sequence
CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCG
ATTTCGACACAATTTATCAGGCGAG...
... important information
in the knowledge of RNase II proteins. To date, there
are no structural or mutational data available from any
other proteins of the family. The SK4803 strain is par-
ticularly ... indi-
cating that the loss of activity in the mutant protein
cannot be restored by increasing the Mg
2+
concentra-
tion.
RNA binding ability of RNase II and the D209N...
... from a thermally unstable
one: frog, toad and newt DNases I all have a Ser205
insertion in a domain that contains an essential Ca
2+
-
binding site in the mammalian enzymes and are thermally
Fig. ... quadrivirgata
,
E. climacophora
and
A. blomhoffii
DNases I
Total RNA was isolated from each snake pancreas by the
acid guanidinium thiocyanate/phenol/chloroform method
[24] and any...
... Ca
2+
signal change and the accompa-
nying conformational change in the canonical EF-hand
are probably relayed to the SAM domain via the
paired ‘hidden’ EF-hand, resulting in the oligomeriza-
tion of ... the
insertion of the helix–loop–helix EF-hand domain
from STIM1, the helical content of the engineered
protein CD2.STIM1.EF increased, indicating that the
insert...
... of the
psbA
mRNA is not affected
in the
mf2
strain
The dramatic decrease in D1 synthesis in mf1 and mf2 strains
did not correlate with any significant changes in the
accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC
ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT
GAA GT-3¢,andtheEcoRI restriction fragment of the
chloroplast genome R14 [16] as a templa...
... of the crystal structures indicates that the side chain of K109
plays a dual role by forming a salt bridge to D137, as well as stabilizing a
glycine-rich loop in the vicinity of the FMN cofactor. ... velocity measurements in
the presence of NADPH as the electron donor and
2-hydroxy-p-naphthoquinone as electron acceptor. The
family of parallel lines obtained f...
... [34]) as a standard. The amounts of chromatophores
and standard protein in the different lanes of a single gel
were kept in the linear range of the luminol assay response.
Light-induced ATP synthesis
Light-driven ... ates
obtained in the absence of a Du. In this case, the impairment
of the ATP synthesis rates in th e mutant was higher than
twofold, es...
... restrictions gov-
erning the combination of features and values in
feature specifications; the definition of the
value range of a feature can thus be regarded as
another special case of cooccurrence ... recognition of the need for
explicit characterizations of the properties that
relate and distinguish similar grammar formalisms.
The paper proposes a series...
... demon-
strate a strong conservation in the binding of C-terminal binding protein-
interacting domains despite great variability in their amino acid sequences.
Finally, this L22 5A point mutation could also ... with the structural data
and the universal conservation of this residue in all C-terminal binding pro-
tein-interacting motifs, mutation of the central leucine re...
... For the detection of the unspliced
pgRNA and the SP1 splicing variant of HBV, primers SP1
(tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and
U2 (ttccaatgaggattaaagacag) were used.
Quantification ... mutagenesis (Stratagene, La
Jolla, CA, USA) using the proofreading DNA polymerase
KOD plus (Toyobo, Osaka, Japan). Deletion mutants are
indicated by a ‘D’ prefix and substitut...