0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx

Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx

Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx

... the majoradvantages as well as the limitations of the presentapproach. The advantages are at least twofold: whilethis highly diversified ligand library is able to greatlyconcentrate rare and ... amenable to analysis by MS and any other analytical tool. Exam-ples are given of analysis of human urine and serum, as well as cell and tissue lysates, such as Escherichia coli and Saccharomyces ... throughout the mass range (from5 to > 200 kDa) can be seen at a glance. In the searchfor novel biomarkers, Equalizer Beads have also beenapplied to plasma and sera by Lathrop et al. [28].Analysis...
  • 9
  • 666
  • 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf

Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf

... Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, HamaguchiS, Sakaizumi M & Nagahama Y (200 7) DMY geneinduces male development in genetically female (XX)medaka fish. Proc Natl Acad Sci USA 104, ... Natl Acad Sci USA 99,11778–11783.9 Matsuda M, Nagahama Y, Shinomiya A, Sato T,Matsuda C, Kobayashi T, Morrey CE, Shibata N,Asakawa S, Shimizu N et al. (200 2) DMY is a Y-spe-cific DM-domain ... sex-reversalmutants in the medaka, Oryzias latipes. Genetics 173,2083–2090.12 Otake H, Masuyama H, Mashima Y, Shinomiya A, Myosho T, Nagahama Y, Matsuda M, Hamaguchi S &Sakaizumi M (200 9) Heritable...
  • 10
  • 860
  • 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R ... through the MTT (A) and colonyformation (B) assays (*P < 0.0 5). 25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA...
  • 9
  • 541
  • 0
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

... Acta 1269, 105–114.38. Agarwal, M.B., Gupte, S.S., Viswanathan, C., Vasandani, D.,Ramanathan, J., Desai, N., Puniyani, R.R. & Chablani, A. T.(199 2) Long-term assessment of efficacy and safety ... Australia), penicillin and gluta-mine from Gibco BRL (Auckland, New Zealand) and streptomycin sulphate from Calbiochem (La Jolla, USA). The synthetic medium, Ultroser G was purchased fromSepracor ... measured at every step of the experiments as described in Materials and methods. Results are the mean and standard deviation from a typical experiment (n ¼ 3), and are expressedas a percentage...
  • 10
  • 545
  • 0
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

... 5¢-GAAAAGCAAGAGTTACCCCCGCGTTTATGGCACAGGAAG5¢-CTTCCTGTGCCATAAACGCGGGGGTAACTCTTGCTTTTCN43 5A Between SOL and M3 5¢-GCTTGAGTTCCAGGCTGTGAGCATCAATGGAGATAAGTATC5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGCS43 7A ... 5¢-GCTTGAGTTCCAGGCTGTGAGCATCAATGGAGATAAGTATC5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGCS43 7A Between SOL and M3 5¢-GGCTTGAGTTCCAGAATGTGGCCATCAATGGAGATAAG5¢-CTTATCTCCATTGATGGCCACATTCTGGAACTCAAGCCN43 5A ⁄ S43 7A Between SOL and M3 5¢-AATGGCTTGAGTTCCAGGCTGTGGCCATCAATGGAGATAAGTATC5¢-ATACTTATCTCCATTGATGGCCACAGCCTGGAACTCAAGCCATTCW39 6A ... 5¢-CCACAGGTATGAGAGTGTTGCAATTCACGGAATCGAAAGG5¢-CCTTTCGATTCCGTGAATTGCAACACTCTCATACCTGTGGR34 7A Motif 2 loop 5¢-CGGAATCGAAGCGGTCGACGAGTTCCACAGG5¢-CCTGTGGAACTCGTCGACCGCTTCGATTCCGW39 6A SOL 5¢-GAAAAGCAAGAGTTACCCCCGCGTTTATGGCACAGGAAG5¢-CTTCCTGTGCCATAAACGCGGGGGTAACTCTTGCTTTTCN435A...
  • 14
  • 357
  • 0
Báo cáo khoa học: Structural study of the catalytic domain of PKCf using infrared spectroscopy and two-dimensional infrared correlation spectroscopy pot

Báo cáo khoa học: Structural study of the catalytic domain of PKCf using infrared spectroscopy and two-dimensional infrared correlation spectroscopy pot

... Sa´nchez-Bautista, Andris Kazaks*, Melanie Beaulande, Alejandro Torrecillas,Senena Corbala´n-Garcı´ a and Juan C. Go´mez-Ferna´ndezDepartamento de Bioquı´mica y Biologı´ a Molecular, Universidad ... 1700–1600 cm )1 interval (amide I) having identical positive and negative area.2D correlation analysis was carried out using the 2d-pocha program written by D. Adachi and Y. Ozaki (Kwan-sei Gakuin ... induced.ResultsInformation on the secondary structure of the catalyticdomain from PKCf (cat-f) was obtained by analysis of the IR amide I band, located between 1700 and 1600 cm )1 and arising mainly from the...
  • 14
  • 383
  • 0
Báo cáo khoa học: Dematin interacts with the Ras-guanine nucleotide exchange factor Ras-GRF2 and modulates mitogen-activated protein kinase pathways doc

Báo cáo khoa học: Dematin interacts with the Ras-guanine nucleotide exchange factor Ras-GRF2 and modulates mitogen-activated protein kinase pathways doc

... in the GAL4 activation domain plasmid pGAD10. The dematinbait and the library was transformed into CG-1945 and plated on media lacking the amino acids tryptophan,leucine, and histidine in the ... growth was designatedby ( ) while failure to activate the L acZreporter gene was designated as (W). (B) Yeastmating between dematin an d Ras-GRF1 and between limatin and Ras-GRF 1 and Ras -GRF2. ... Yeast two-hybrid a nalysis. (A) Sche-matic representation o f dematin and R as±GRF2 interaction. The carboxyl-terminal halfof dematin (amino acids 224±38 3) was used as the bait for the yeast...
  • 12
  • 405
  • 0
Báo cáo khoa học: Spectroscopic characterization of the oxyferrous complex of prostacyclin synthase in solution and in trapped sol–gel matrix doc

Báo cáo khoa học: Spectroscopic characterization of the oxyferrous complex of prostacyclin synthase in solution and in trapped sol–gel matrix doc

... dithionite, the Soret peak was blue-shifted from 418 to 412 nm,accompanied by a decrease in intensity, whereas the Q band (a collective term for the a and b bands), withan a- band peak at 570 nm and a ... encapsulated PGISinteracted with the heme ligands. We chose U46619(an O-based ligand; a substrate analog whose oxygenatom at the C9 position is replaced with a carbonatom), NaCN (a C-based ligand) ... acid as the substrate and guaia-col as the cosubstrate. Enzymatic activity was followedby absorbance changes at 470 nm that monitored the oxidation of guaiacol. Upon the addition of peraceticacid...
  • 10
  • 422
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... PAGE, the peak comprised all of the subunits from the enzyme (a, b, and c) and the reactivase (a and b) (data notshown). It was thus evident that this peak contained the enzymeÆreactivase complex(es) ... nondenaturing PAGE, the bands of the enzyme and the reactivase were markedly reducedin density, and two bands of the enzymeÆreactivasecomplexes (upper and lower) appeared above them(Fig. 5A, lane ... reacti-vase; (c) enzymeÆCN-Cbl complex + reactivase (+ADP); (d) enzy-meÆCN-Cbl complex (+ADP); (e) apoenzyme + reactivase (+ADP);(f) apoenzyme (+ADP); (g) reactivase (+ADP). +ADP indicates thatsamples...
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... Ivanova N, Sorokin A, Anderson I, Galleron N,Candelon B, Kapatral V, Bhattacharyya A, Reznik G,Mikhailova N, Lapidus A et al. (200 3) Genomesequence of Bacillus cereus and comparative analysiswith ... G AB catalysis have been identifiedto date [12] which are based either on a single, bifunc-tional GAB catalyst or on a GAB catalysts pair. The available biochemical data on MshB and LpxC are ... a 6) and a C-terminal strand (b 8). Helix a5 and strand b7 partially cover one side of the Ross-mann fold structure, thereby interacting with helices a1 , a2 and strand b5, respectively. The a5 -helix...
  • 11
  • 710
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ