Báo cáo khoa học: A novel isoform of pantothenate synthetase in the Archaea potx

... in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans.Also, they are absent from the Bacteria andEukaryota. All of the Archaea that have ... reconstruction in the Archaea. The linear pathway leading from a- ketoisovalerate to CoAcomprises eight steps in the Bacteria and Eukaryota. It proceedsvia pantoate, pantothenate (vitamin B5), and 4¢-phosphopantothe-nate. ... protein families as the best candidates for the missing steps in archaeal CoA biosyn-thesis. The functional assignments for COG1701 (archaeal PS) andCOG1829 (archaeal PANK) are explained in the...

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas. The characteri-zation and functions of prosemin are described.ResultscDNA cloning and structure of the ... (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnIsites to produce pTSd. The cDNA fragment ... prosemin was detected as a single band by silver staining (lane 2).(B) After activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated...

Tài liệu Báo cáo khoa học: "A Shallow Model of Backchannel Continuers in Spoken Dialogue" potx

... model was applied to the test set.4.3 n-gram Part -of- Speech ModelSeparating the data into training, validation and testsets was carried out by generating a random dialogueID. The IDs are in the ... test data. The validation data wasnecessary for building the CMU-Cambridge languagemodel, but was concatenated with the training set for the other models. The model was forced to back-off to a ... and case/adverbial particles and adverbialverb forms, coupled with the FO contours flat-falland rise-fall.Ward & Tsukahara (2000) modeled the location of backchannel continuers in Japanese...

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

... Thomas-Oates, J.E. & Brade, H. (1994) Preparationand structural analysis of oligosaccharide monophosphatesobtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota ... which links the O-7 of a Hep residue, and a 2-amino-2-deoxy galactose (GalN), which is the branchingpoint of the oligosaccharide. The amino function of the GalNresidue is frequently acylated ... KOH. The lipo-oligosaccharide was also analyzed after acid treatment,attained by mild hydrolysis with acetic acid, to obtaininformation on the nature of the phosphate and acyl groups. The two...

Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efﬁcient catalysis doc

... within the hexamer. Specifically, these cru-cial ‘flex points’ appear to be at the back of the gluta-mate binding domain near residue 35 and within the GTP binding site. Again, the loop that contains ... demonstrate thatzinc does indeed cause changes in local flexibility, andit is interesting that all of the zinc-induced changes areregions located either at the base of the antennaeregion of the ... complexes. In the absence of glutamate zinc appears to significantlytighten NADPH binding. Interestingly in the presence of norvaline zinc has little effect on the binding of NADPH. The major conclusion...

Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

... against a shifting target: a structural basis forresistance to inhibitors in a variant of in uenza virusneuraminidase. Structure 6, 735–746.13 Ely B & Pittard J (1979) Aromatic amino acidbiosynthesis: ... werepurchased and used in further evaluation of theirantimycobacterial activities.Antimycobacterial activities of the selectedligands in vitroWe ﬁrst evaluated the antibacterial activity of 50ligands ... the autodockapproach. The docking dummy center was arranged in the middle of the barrel composed of C-termini of b-sheets. The radius of the docking region was 22.5 A ˚,and it was beyond the...

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... GCGGGTACCAATGTGATGGGTGGACTGGThRhoA +166 GCGAAGCTTACCAGACCGTGGACTAACGAhRhoB sense CCCACCGTCTTCGAGAACTAhRhoBantisenseCTTCCTTGGTCTTGGCAGAGhRhoA sense CCAGACTAGATGTAGTATTTTTTGhRhoAantisenseATTAGAGCCAGATGCTTAAGTCCGAPDH-F ... 3T3fibroblasts. These data reveal a novel mechanism of cross-talk between the classical TGFb ⁄ Smad pathway and Rho GTPases, regulating the rapidand the long-term actin reorganization that may control ... interactionswith an existing GEF, or finally by acting as GEFsthemselves. Finally, in fibroblasts, the TGFb–Smadpathway causes transcriptional activation of the a- SMA gene and its incorporation into...

Báo cáo khoa học: "A Computational Model of Text Reuse in Ancient Literary Texts" potx

... amount of training data available4, the feature space must be kept small to avoid overﬁt-ting. Starting with the cosine similarity score as the baseline feature, we progressively enrich the modelwith ... (partially) shared by some of the other seven re-searchers.Comparison with Other HypothesesAnother way of evaluating the output of B andJ is to compare them with the hypotheses of otherresearchers. ... hy-potheses listed in Table 2, yielding two models, Band J.Table 3 shows the increasing accuracy of bothmodels in describing the text reuse in Ltrainasmore features are incorporated. The...

Báo cáo khoa học: "A Uniform Treatment of Pragmatic Inferences in Simple and Complex Utterances and Sequences of Utterances" pot

... be cancelled. We are not aware of any forma- lism or computational approach that offers a unified explanation for the cancellability of pragmatic inferences in general, and of no approach ... contains more information and that information can be more easily updated in the fu- ture. That means that if an interpretation m0 makes an utterance true by assigning to a relation R a defensible ... utterance that is analyzed. The problem with these approaches is that they as- sign a dual life to pragmatic inferences: in the initial stage, as members of a simple or complex utterance, they are...

Báo cáo khoa học: "A COMPOSITIONAL SEMANTICS OF TEMPORAL EXPRESSIONS IN ENGLISH" pptx

... Point as an admiral, and not, as is actually the case, subsequent to graduation from the Naval academy. Notice that the formula in (33) , which represents the translation of (31) in my analysis, ... graduated at the same time, 2. since the P operator forces temporal evaluation of all predicates in its scope at the same index, in the case of (31) it requires that every admiral graduated ... any larger elements in a sentence, and 2. verb meanings as well as noun meanings are indexi- cal in the sense their interpretations depend on the context of the utterance in the same way that...

Xem thêm