Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc
Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc
... generate the
monomeric form of the CP. Furthermore, we have shown that residue F13
is critical for self-assembly of the CP subunits into NLPs. The replacement
of F13 with hydrophobic residues ... led to formation of either NLPs (F13Y and
F13L) or monomeric forms of the protein (F13G,
F13A, F13R, F13E, F13S), which were always
detrimental to accumulation of...
Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt
... primer for construction of truncated
AmyQ variants for synthesis of nascent chains
amyQ95 GCCGGATCCTTCTCCTAAATCATACAA Amplification primer for construction of truncated
AmyQ variants for synthesis of ... around the filter, which can be visualized by staining
of the plates with iodine vapor. The radius of the resulting
halos is indicative for the amounts of ac...
Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc
... January
2011)
doi:10.1111/j.1742-4658.2011.08018.x
NOX is the catalytic subunit of NADPH oxidase, the superoxide-generat-
ing enzyme. Among several isoforms of NOX, NOX4 is abundantly
expressed in various tissues. To clarify the mechanisms of ... dramatically decreased
by the deletion of GC-box1. The activity was further
decreased by the deletion of GC-box2 (Fig. 3...
Báo cáo khoa học: "A Stacked Sub-Word Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" potx
... was then further
used in POS tagging in (Ng and Low, 2004). One
main disadvantage of this model is the difficulty in
incorporating the whole word information.
The second kind of solution is the ... Seg
C
and
SegTag
L
are the predictions of the three coarse-
grained solvers. For the three words at the begin-
ning and the two words at the end, the three predic-...
Báo cáo Y học: DAP kinase activity is critical for C2-ceramide-induced apoptosis in PC12 cells ppt
... triggers the formation of reac-
tive oxygen species, the disruption of electron transport and
energy metabolism, and the release of caspase-activating
proteins, c ytochrome c, a nd apoptosis-inducing ... residue within the kinase domain is
replaced by an alanine residue, is inactive. The death-
promoting function of DAP kinase requires t he kinase
activity; therefore...
Báo cáo khoa học: Hydrogen bond residue positioning in the 599–611 loop of thimet oligopeptidase is required for substrate selection pdf
... requires
neither Tyr residue for efficient turnover by TOP. This
distinction among substrates has allowed for a careful
analysis of the role of the conserved Gly residues in
the 599–611 loop. The flexibility ... the flexible loop
region of TOP is responsible for this enzyme’s posi-
tioning of substrates for catalysis [15]. The present
results clarify the prima...
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
... signal is impaired.
We finally examined the effect of deletion of the
components of the PDZ binding motif on the signal-
ing properties of the receptor in Ca
2+
imaging
experiments. Truncation of the ... and have elucidated the molecular
details of this interaction.
The primary source of olfactory signaling and the
sites of expression of ORs are the cil...
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx
... during the f orced
molecular dynamics calculated with the torque of 56 pNÆnm. The
secondary structure of c is shown for the time of 1 ns (the end of initial
equilibration), 17 ns (half of turnover), ... main axis of the shaft. The ‘bearing’ included a
total of 138 residues from the neighbouring portion of (ab)
3
located within 1.8 nm from the rotary axis (...
Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the first cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx
... given in Fig. S2.
The regioselectivity of CYP77A4 was determined on the
basis of the peak area of each metabolite detected by GC.
Metabolites of oleic acid
For the analysis of the products generated ... S4. The regioselectivity of CYP77A4 was
determined on the basis of the peak area of each metabolite
detected by GC.
Metabolites of linoleic acid
For the...
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt
... b-sheet A to form a latent conformer [16].
However, this is unlikely as the latent conformer of the
serpins is unable to form polymers [17,18]. Other charac-
teristics of the latent conformer are ... of Ser52Arg neuroserpin is similar to that
of the polymeric conformation in which b-sheet A is filled
with the reactive loop of another neuroserpin molecule.
Moreover t...
Từ khóa:
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- chuyên đề điện xoay chiều theo dạng
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- chuong 1 tong quan quan tri rui ro