Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... c-lyases from
the enteric protozoan parasite Entamoeba histolytica
against physiological substrates and trifluoromethionine,
a promising lead compound against amoebiasis
Dan Sato
1,
*, Wataru Yamagata
2
, ... catalyzes the a, c-elimination
and c-replacement of l-Met and homocysteine (Hcy),
and a, b-elimination and b-replacement of l-Cys an...
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx
... m
M Mes (pH 7) and substrate (5¢-G
2
CCCUCUAAAAA-3¢)at50°C
[6].
c
Substrate-cleavage reaction (exogenous guanosine-mediated)
of the substrate (5¢-CUUAAAAA-3¢) using the Anabaena ribozyme
(L-8 ... 1)
[14,17,21].
Dependence of substrate cleavage on pH
It has been reported that the rate of the substrate-
cleavage step in Tetrahymena [22–25], Anabaena [14]
and Azoarcus [17] grou...
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx
... properties and subcellular localization patterns of the enzyme.
USP7 is phosphorylated at S18 and S963, and ubiquitinated at K869 in
mammalian cells. In in vitro activity assays, N- and C-terminal truncations
affected ... M1 and
E20, an alpha helix from there and up to amino acid
G28, followed by a b-sheet starting at T36 and extend-
ing to residue L49, and a larger...
Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx
... transla-
tion. The target application of the method is auto-
matic or semi-automatic compilation of a glossary or
technical-term dictionary for a certain domain. Re-
cursive application of the ... Automatic Collection of Related Terms from the Web
Satoshi Sato and Yasuhiro Sasaki
Graduate School of Informatics
Kyoto University
Sakyo, Kyoto, 606-8501
Japan
sato@i.kyot...
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... observe the appearance of two
peaks at 1618 and 1683 cm
)1
, which are typical of
the formation of an intermolecular antiparallel b-sheet
aggregate [21].
The thermal stability of b-glucosidase was assessed
by ... acid and the DNA level, respec-
tively; they also have a similar catalytic mechanism
and substrate specificity. However, the molecular basis
of the high...
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... 5¢-GAGCCAACAGAAGTTTGCT
TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and
5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC
TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG
CAGAAATTCAGTAGCAACATGGTGGAACGATGTC
TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC
CATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga
auaaacaaugcaacaaagauuguagaagucag
UGUACAUA
At4g36040 (1) Protein containing DNAJ domai...
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... LB400 through a PCR with GAGCGG
CATATGGA
AATCAAACCGAAGGTTCGCGA and GAGCGG
CATA
TGGAAATCAAACCGAAGGTTCGCGA as the forward
and reverse oligonucleotide primers, respectively. The
primers were designed ... Wellenreuther
and W. Meyer-Klaucke for data collection and assis-
tance in data evaluation. The assistance of T. Pavkov
(Institute of Chemistry, University of Graz) in the...
Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf
... 7.0 at 25 °C.
The effect of each ligand on related pairs of substrates
(neutral substrates o-NAC and o-NPA, and positively
charged substrates ATMA and ASCh) was compared. To
avoid complications ... analysis of BuChE AAA activity was carried out with
a positively charged acetanilide (ATMA), a negatively
charged acetanilide (NATAc) and neutral acetanilides
(o-NAC and...
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... at the
same time, distinct absorption bands of oxyheme
appeared at 540 and 579 nm. Then, a broad band
appeared at around 660 nm, and was maximal 9–12 min
after initiation of the reaction. The ... estimated directly from the
values of absorbance at these maxima (data not
shown). The estimated association constants for imi-
dazole and azide binding to heme–GmHO-1 are s...
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt
... DASA
polar
are the changes in
ASA of the apolar and polar residues, respectively
[39]. The structure-based calculations provide a DC
p
of
)407 calÆmol
)1
ÆK
)1
and DASA
apolar
and DASA
polar
of
)1354 and ... and without
the receptor N-domain using the vadar program
[41].
The DC
p
was calculated using the following equa-
tion:
DC
p
¼ 0:45DASA
apolar
À 0:26 ASA
p...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- báo cáo khoa học về cá tra
- báo cáo khoa học nghiên cứu chôm chôm
- trạng thái hiện sinh báo cáo khoa học
- biểu tượng văn học báo cáo khoa học
- tài liệu báo cáo khoa học
- cách trình bày báo cáo khoa học
- báo cáo khoa học toán học
- cách làm báo cáo khoa học
- trình bày báo cáo khoa học
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật