Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... Authors Journal compilation ª 2007 FEBS Characterization of inhibitors of PDE1C T. R. Dunkern and A. Hatzelmann Characterization of inhibitors of phosphodiesterase 1C on a human cellular system Torsten ... lL of a substrate solution (Promega, Madison, WI,USA; CytoTox96 assay), and after 15 min of incubation,an additional 50 lL of a stop solution. Thereafter, extinctionwas measured at a wavelength ... GATCATGCACTGAAATTTA (2), GATGAAACCTCTCAAACTG (3), and CATCATCGCTGGACAATGT (4)], usingT. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1CFEBS Journal 274 (2007) 4812–4824 ª 2007 The Authors...

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... models of octaga-lacturonate, using three polygalacturonases (including A. aculeatus polygalacturonase), and concluded that thebinding clefts in polygalacturonases can accommodatemaximally eight ... liberate monogalacturonic acid as the ﬁrst and onlyproduct on PGA and oligoGalpA. On the basis of itsmode of action, PelB should be classiﬁed as an exo-polygalacturonase (EC 3.2.1.67). To date, ... al. An exopolygalacturonase from Thermotoga maritimaFEBS Journal 272 (2005) 5464–5473 ª 2005 FEBS 5467 on GalpA ranging from digalacturonate to octagalac-turonate. For all concentrations, a typical...

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 CGGCGCGTCATATGGCCAGTCATGATAARA457 ... CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460 CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC AGG CTT ATC ATG...

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... Philadelphia, Pa. 19104 ABSTRACT: The design and implementation of a paraphrase component for a natural language questlon-answer system (CO-OP) is presented. A major point made is the role of ... the auxiliary verb. The cycle of transformations invoked thru application of negation is completed with the contraction transformation. The statement of the contraction transformation ... an examination of the effect of context on word meaning and of the intentions of the speaker on word or phrase choice. The lack of a rich semantic base and contextual information dictated...

Tài liệu Báo cáo khoa học: The capsid protein of human immunodeﬁciency virus: designing inhibitors of capsid assembly ppt

... assembly.Variants of CAI peptideArmed with this structural information on CAI, Zhanget al. [32] used a structure-based rational designapproach to stabilize the a- helical structure of CAIand also ... and Gln192) is one of the residues that decreases the association constant of CTD, as previously demonstrated in an alaninescanning of the dimerization interface [23].Barklis et al. [31] have ... of theassembly-competent mutants E18 7A and N18 3A: theconformations of the two assembly-incompetentmutants (Y16 9A and L21 1A) in the absence of CAIare the same as the structures of any mutant...

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... from human adenocarcinomasAnna Maria Luciani1, Sveva Grande1, Alessandra Palma1, Antonella Rosi1, Claudio Giovannini2,Orazio Sapora3, Vincenza Viti1and Laura Guidoni11 Dipartimento ... arachidonic acid chains, andat 0.93–2.04 p.p.m., attributed to linolenic acid chains on the basis of a comparison with lipid extracts andfrom the data available in the literature, are alsoclearly ... Authors Journal compilation ª 2009 FEBSand HeLa cells, becoming 20% and 8%, respectively,after irradiation. The standard deviation in repeatedcalculations was 2%. The relative concentrations...

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-CCATGAAGTCCGCGAATC-3¢); andQsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) andQaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). Theabbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense andantisense primers. Accurate ... generated by 5¢-and 3¢-RACE using the Marathon cDNA ampliﬁcation kit(Clontech, Takara, Mountain View, CA, USA). Double-stranded cDNA from oyster mantle edges was ligated toadaptors, and 25 ... behaves as a chemotacticcytokine that recruits cells to sites of inﬂammation andpromotes eosinophilia around larvae of nematodeparasites [10], mediation of immune cell (haemocytes)migration...

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... with a splicing junction.Conﬁrmation of utilization of exon 1a as a transcription initiation exon and occurrence of alternative splicingTo examine whether exon 1a is used as a transcriptionstarting ... Kominato Y, Yamamoto F & Takizawa H(2002) Characterization of the human ABO gene pro-moter in erythroid cell lineage. Vox Sang 82, 39–46.34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y &Kishi ... including characterization of the promoterregion of the gene and the associated transcriptionalfactors. Therefore, delineation of the transcriptionalregulation of human DNASE1 may provide...

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... regula-tion of proton pumping activity in different cells typesand physiological conditions takes place at both thetranscriptional and translational levels [1–4].As to post-translational regulation, ... further enhances FC-stimulatedH+-ATPase activity [22].Here we report a characterization of the interaction of PPI1 with the H+-ATPase in PM isolated fromcontrol and FC-treated A. thaliana cultured...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream ... standard assay buffer, and activity towards Suc-AAPF-pNA was measured using standard assay condi-tions. One hundred percent activity refers to enzymesamples assayed using standard conditions...

Xem thêm