Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT135mC9.R: GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC706mCARP.R: TGGCACTGATTTTGGCTCCTE2-14 ... TCACAGGACACTGAGCAATGGCTGATC1691p21.R: GTGCTTTGACACCCACGGTAUb Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG51mUbiq.P: TGTTTCGACGCGCTGGGCG96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA Cardiac ankyrin ... disuse atrophy in rat skeletal muscle. J Physiol551, 33–48.12 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y,Tanaka T, Takeda S, Tomaru K, Sekiguchi K, Arai M,Nakamura T et al. (2000) Cardiac ankyrin...

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢;and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢.Direct ... members of the Ras family of small G proteins.The activity of Ras proteins is under tight control of several classes of guanine nucleotide exchange factors(GEFs) and GTPase-activating proteins. MammalianSon ... Dasgupta C, Li P, Liu BX & Broek D (1992) Identiﬁ-cation of a mammalian gene structurally and function-ally related to the CDC25 gene of Saccharomycescerevisiae. Proc Natl Acad Sci USA...

Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

... 1283–1297.24 Sakaki-Yumoto M, Kobayashi C, Sato A, Fujimura S,Matsumoto Y, Takasato M, Kodama T, Aburatani H,Asashima M, Yoshida N et al. (2006) The murinehomolog of SALL4, a causative gene in ... USA)and flowjo software (TreeStar, Ashland, OR, USA).Mice and teratoma formationC57BL ⁄ 6J mice and MCH:ICR mice were purchased fromCLEA Japan (Tokyo, Japan). All of the mice were main-tained ... compilation ª 2009 FEBS 6667homologue of rat polypyrimidine tract binding protein. J Biochem 128, 811–821.18 Yamamoto H, Tsukahara K, Kanaoka Y, Jinno S &Okayama H (1999) Isolation of a mammalian...

Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf

... 5¢-TCCTCCACTATAAAAGGAAATG-3¢ andDELa forward 5¢-TTATAGTGGAGGAAAATAAGAC-3¢;DELb reverse 5¢-AACAGTCCATTTTAGTCCTT-3¢ andDELb forward 5¢-AAAATGGACTGTTCTTTCTT-3¢;DELc reverse 5¢-TACCTAGAAGAAAGAACAGT-3¢ ... severalin-house antibodies against PTB, hnRNP A1 ⁄ A2 ⁄ C and Hproteins and commercial antibodies against ASF ⁄ SF2(Zymed, Carlsbad, CA, USA), SC35 (Sigma) and SRp55(1H4 antibody, Zymed). Protein ... temperature,ethanol-precipitated, and resuspended in 100 lL of 0.1 mNaOAC, pH 5.0. To this RNA, 300 lL of an adipic aciddehydrazide agarose bead 50% slurry (Sigma) equilibratedin 100 mm NaOAC pH 5.0 were added, and...

Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx

... prepare RNA ⁄ DNA hetero-duplexes, a 44 nucleotide long R01 RNA (5¢-GGGCGAAUUCAAAACAAAACAAAACUAGCACCGUAAAGCLeishmania LeIF is an eIF 4A- like RNA helicase M. Barhoumi et al.5096 FEBS Journal ... HindIII-cut plasmid was used tomake a 45 nucleotide long K06 RNA (5¢-GGGCUAGCACCGUAAAGCAAGUUAAUUCAAAACAAAAGCU-3¢).It was hybridized to the same 5¢ [32P]-labeled DNA oligo-nucleotide at the sequence ... world-wide-distributed, parasitic diseases caused by proto-zoan parasites of the genus Leishmania that aretransmitted by female sandﬂies. Leishmania are Tryp-anosomatidae protozoans having two main stages intheir...

Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

... revealed a band of approxi-mately 60 kDa, presumably the a chain of matureMSP (Fig. 1A) . Generation of a band of approxi-mately 30 kDa, presumably the b chain, was alsodetected by an anti-His ... peritoneal resident macrophages [1–3].Mature MSP is a disulﬁde-linked heterodimer with a relative molecular mass of 80–95 kDa, consisting of an a chain of approximately 60 kDa and a b chain of approximately ... proteinases(cell surface activator), such as matriptase [9]. Matriptase is also a potent activator of pro-HGF/SF [12,30]. The second pathway is mediatedby humoral activators that are generated...

Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a speciﬁc receptor for the antiapoptotic ubiquitin-like protein Scythe docx

... 1767–1777.25 Kawahara H, Kasahara M, Nishiyama A, Ohsumi K,Goto T, Kishimoto T, Saeki Y, Yokosawa H, ShimbaraN, Murata S, et al. (2000) Developmentally regulated,alternative splicing of the Rpn10 ... Kobayashi1, Keiji Tanaka2,Hideyoshi Yokosawa1and Hiroyuki Kawahara11 Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, Japan2 Department ... 279–284.40 Takayama S & Reed JC (2001) Molecular chaperonetargeting and regulation by BAG family proteins. NatCell Biol 3, E237–E241.41 Takayama S, Bimston DN, Matsuzawa S, Freeman BC,Aime-Sempe...

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... K, Hieda N, Yamanishi M, Shibata N &Toraya T (2005) Crystallization and preliminary X-rayanalysis of molecular chaperone-like diol dehydratase-reactivating factor in ADP-bound and nucleotide-freeforms. ... glyceroldehydratase-reactivating factor reactivates the inacti-vated hologlycerol dehydratase in a similar manner.Both dehydratase-reactivating factors exist as a 2b2heterotetramers [a, DdrA or GdrA ... cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damagedcofactor to pass through it. Intact cofactor, an ade-nine-containing cobalamin, is not released from theenzyme...

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... cellu-lar networks allows the simpliﬁcation of the set of equations by assuming a steady state of the intra-cellular metabolites. An approach that combines ﬂuxbalance analysis (FBA) with an ordinary ... design of bacterial strainsbased on mathematical models.Nishio et al. [15] provided simulation data of theirmodel and discussed the agreement with literatureexperimental data from a qualitative ... culturesallow the determination and analysis of the dynamicsin different time windows. The analysis of the mutantstrains clearly showed that a large experimental effort is necessary for the rational...

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... becomesfeasible for libraries in which a larger number of aminoacids are varied simultaneously. Primordial protein catalystsmay have had to manage with signiﬁcantly fewer than the20 amino acids ... in clinical isolates. Such rapid laboratoryevolution may be useful to better anticipate the naturalevolution of bacterial antibiotic resistance. Hydrolysis of aztreonam requires a change in ... thebifunctional enzymes chorismate mutase–prephenate dehydratase and chorismate mutase–prephenate dehydratase were deleted. Monofunctionalversions of the dehydratase and the dehydrogenase are provided...

Xem thêm