Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
... against a shifting target: a structural basis forresistance to inhibitors in a variant of influenza virusneuraminidase. Structure 6, 735–746.13 Ely B & Pittard J (1979) Aromatic amino acidbiosynthesis: ... 18.00Pro63 fi Ala 2.49 2.20 Ala190 fi Ala ND NDSer64 fi Ala 1.53 1.40 Arg191 fi Ala 6.63 5.87Glu168 fi Ala 21.67 19.17 Asn192 fi Ala 2.57 2.28Val169 fi Ala 1.53 1.40 Leu193 fi Ala 1.42 1.25His170 fi Ala 1.19 ... of ATB107 binding onenzyme activity, we tested the catalytic activity of mIGPS in the presence of this ligand. A plot of theligand concentrations against mIGPS activity (Fig. 6A) showed that...
- 11
- 440
- 0
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt
... & Brade, H. (1994) Preparationand structural analysis of oligosaccharide monophosphatesobtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota and Escherichia coli ... Gram-negative bacteria, and their adaptability tomany different pollutants [1].Pseudomonas stutzeri OX1 is a Gram-negative bacteriumisolated from the activated sludge of a wastewater treatmentplant, ... atomsbearing carbon signals, at 4.26/49.8 p.p.m. (H-2/C-2 X)and3.67/56.1 p.p.m. (H-2/C-2 W), in agreement with theabsence of Lipid A disaccharide and with the presence of a a-galacto and a...
- 14
- 715
- 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc
... 3), allowing both anamplitude and rate constant for the pre-steady statephase to be calculated. The parameters for both thesteady state phase and the pre-steady state phase aregiven in Table ... JE & Dalziel K (1973) A conformational transition of the oligomer of glutamate dehydrogenase induced byhalf-saturation with NAD+ or NADP+. BiochimBiophys Acta 309, 237–242.8 Alex S & ... regulatedby a diverse array of small molecules, with ADP,GTP, leucine and the combination of malate and pal-mitoyl CoA being the most effective regulators of the activity [20–22]. The enzyme was...
- 12
- 544
- 0
Báo cáo khoa học: A novel isoform of pantothenate synthetase in the Archaea potx
... of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans.Also, they are absent from the Bacteria andEukaryota. All of the Archaea that have archaeal-typePS ... bothATP and ADP have a strong effect on the rate of theMM2281-catalyzed pantothenate–b-alanine exchangereaction. The simplest explanation for this behavior isthat pantoate, ATP and ADP are all ... theArchaea. The linear pathway leading from a- ketoisovalerate to CoAcomprises eight steps in the Bacteria and Eukaryota. It proceedsvia pantoate, pantothenate (vitamin B5), and 4¢-phosphopantothe-nate....
- 11
- 626
- 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... CCCACCGTCTTCGAGAACTAhRhoBantisenseCTTCCTTGGTCTTGGCAGAGhRhoA sense CCAGACTAGATGTAGTATTTTTTGhRhoAantisenseATTAGAGCCAGATGCTTAAGTCCGAPDH-F ACCACAGTCCATGCCATCACGAPDH-R TCCACCACCCTGTTGCTGTAL. Vardouli et al. Rho GTPases ⁄ Smad proteins ... GGGATCAGAGTTCATAGTGAAAAGAGhRhoB +86 GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTChRhoA )799 GCGGGTACCAATGTGATGGGTGGACTGGThRhoA +166 GCGAAGCTTACCAGACCGTGGACTAACGAhRhoB sense CCCACCGTCTTCGAGAACTAhRhoBantisenseCTTCCTTGGTCTTGGCAGAGhRhoA ... 3T3fibroblasts. These data reveal a novel mechanism of cross-talk betweenthe classical TGFb ⁄ Smad pathway and Rho GTPases, regulating the rapidand the long-term actin reorganization that may control...
- 14
- 420
- 0
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf
... with buffer A. The desalted extractwasappliedtoa5mLAmersham/PharmaciaHi-trapQanion exchange column that had previously been equili-brated with buffer A. The protein was eluted with a linearKCl ... mMphosphoenolpyru-vate2, and appropriate concentrations of UDP-glucose andfructose. Pyruvate kinase and lactate dehydrogenase wereeach added to a final activity of 4 UÆmL)1.NADHoxidation was monitored at ... 8].MCA has been discussed in the context of plant metabolism[9] and further examples of its application are given therein,as well as practical advice on isolation and assay of plantenzymes and...
- 7
- 414
- 0
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
... Gb3 synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; ... functional char-acterization of human cDNA for ganglioside GM3 synthase. J Biol Chem 273, 31652–31655.26 Nomura T, Takizawa M, Aoki J, Arai H, Inoue K,Wakisaka E, Yoshizuka N, Imokawa G, Dohmae ... Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler-ated transport and maturation of lysosomalalpha-galactosidase A in Fabry lymphoblasts by anenzyme inhibitor. Nat Med 5, 112–115.29 Mattocks...
- 12
- 303
- 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... (sense) and5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primersfor unmethylated DNA were: 5¢-GAAGTAGGTGGAGTATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCTACTT-3¢ (antisense).Caspase 3 activity Cells ... caspase assay were seeded on a 24-well plate and transfected with FuGENE 6. The caspaseassay was performed using the CaspACE colorimetric assaykit as described by the manufacturer (Promega). ... treatment with 5 lm 5¢-aza-2¢-deoxycytidine (5¢-aza-dC), an inhibitor of DNA methyltransferase 1, and 300 nmtrichostatin A (TSA), an inhibitor of histone deacety-lase (Fig. 2B). In the same treated...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt
... receptors,and invertebrate tachykinins: a review. Zool Sci 5,533–549.7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy-ama M, Minakata H, Chiba T, Metoki H, Satou Y &Satoh N (2004) Tachykinin and ... vulgaris).Biochem J 387, 85–91.25 Kanda A, Takahashi T, Satake H & Minakata H (2006)Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated ... Winther AM, Nachman RJ,Taylor CA, Shirras AD, Coates D, Isaac RE & NasselDR (2000) Expression and functional characterization of a Drosophila neuropeptide precursor with homologyto mammalian...
- 11
- 595
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... only as a carbon source, but also as a nitrogensource for g rowth of the assimilating bacteria. Deaminases,which catalyze the release of ammonia, are a key enzyme inthe metabolic pathways of ... NADPH, and glutamate dehydrogenasewere from Wako Pure Chemicals (Osaka, Japan); meatextract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo(Osaka, Japan); and pentafluorophenylhydrazine was ... not have anabsorbance peak at 300 nm [5]. A cofactor is not requiredfor t he enzyme activity. In contrast, the deaminase fromstrain 10d contained an FAD-like cofactor, similar toD-amino acid...
- 7
- 613
- 1
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP