Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... to the single canonical EF-hand, there is a ‘hidden’, atypical, non-Ca2+-binding EF-hand motif that stabilizes the intramolecular inter-action between the canonical EF-hand and the SAMdomain. ... A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+Yun Huang, Yubin Zhou, Hing-Cheung Wong, Yanyi Chen, Yan Chen, Siming Wang,Adriana Castiblanco, Aimin ... lumen are sensed by the canonical EF-hand motif and cause conformational changes in this motif. The Ca2+signal change and the accompa-nying conformational change in the canonical EF-hand are...

Báo cáo khoa học: A chromatin-associated protein from pea seeds preferentially binds histones H3 and H4 pptx

... protein, the cDNAencoding p16 was obtained from the psp54 (28) cDNA. The oligonucleotides used as primers were: 5¢-CCCCTCGAGATGTCTAGACAAAAAAAGAGTAG-3¢ and 5¢-CCCCTCGAGTCACACAACAGCACGAC-3¢.ThePCRproduct ... N-terminal tails areinvolved in protein binding. They are accessible both in the nucleosome [2] and in chromatin [17] and they are the site of post-translational modiﬁcations that can modulate ... [14C]acetyl-CoA in the presence of yeast recombinantEsa1p. AUT/PAGE (acetic acid/urea/Triton X-100/PAGE)analysis showed that H3 and H4 are almost fully acetylated,while H 2A contains a mixture of acetylated...

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

... thrombin slowly and continuously dissociated from the immobilized TM at the same rate as in the absence of PAI-1 and no increase in surface-bound mass was observedas a result of PAI-1 binding ... Poly-sorbate-20 (Surfactant P20), and all additional BIAcorematerials were obtained from BIAcore AB (Uppsala,Sweden).ProteinsOvalbumin (grade V) was obtained from Sigma. Rabbit-lung TM (rl-TM) was ... encounter of serpin and protease caneither lead to formation of the enzyme/inhibitor complex orcan result in cleavage of the inhibitor and release of activeenzyme. A decreased overall inhibition rate...

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... quadrivirgata,E. climacophora and A. blomhofﬁiDNases ITotal RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method[24] and any DNA contamination was ... generating a thermally stable enzyme form from a thermally unstableone: frog, toad and newt DNases I all have a Ser205insertion in a domain that contains an essential Ca2+-binding site in the ... Roche Diagnostics. All the other chemicals usedwere of reagent grade and available commercially. The snakes and Japanese white rabbits were acquired, main-tained and used in accordance with the...

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... underline).Name Size (nt) SequenceCLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE...

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deﬁciency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... of the psbAmRNA is not affected in the mf2strain The dramatic decrease in D1 synthesis in mf1 and mf2 strainsdid not correlate with any signiﬁcant changes in the accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCCATG GAA TCG ATG TAT AAA CGG TTT TCA GTTGAA GT-3¢,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a template. The resultingDNA fragment ... 52 column. Heptanoic acid was used asan internal standard.Results The absence of functional PSII and lack of PG-C16:1(3t)result from a single nuclear mutationTo assess the relation between...

Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx

... velocity measurements in the presence of NADPH as the electron donor and 2-hydroxy-p-naphthoquinone as electron acceptor. The family of parallel lines obtained from data analysisindicates a ping-pong ... states of the different variants in the crystalline state were analyzed using the msd-pisaserver [20] taking into account all the interactions of protein chains within the asymmetric unit as ... to main-tain the native state of proteins. Native PAGE was per-formed for 4 h at 90 V and 4 °C. In addition, DLS of wild-type YhdA and the four protein variants was carriedout with a DynaProÔ...

Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

... the malE-malF substrate at 37 °C in the presence or in the absence of EDTA. As shown in Fig. 6A, incubation of the wild-type protein with the RNA sub-strate in the absence of EDTA resulted in ... important information in the knowledge of RNase II proteins. To date, thereare no structural or mutational data available from anyother proteins of the family. The SK4803 strain is par-ticularly ... shown), indi-cating that the loss of activity in the mutant proteincannot be restored by increasing the Mg2+concentra-tion.RNA binding ability of RNase II and the D209Nmutant The data presented...

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... to clone the MABO gene. The DNA fragment carrying the MABOORF was ampliﬁed with the primer pair 5¢-GACCTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear-ing the restriction ... role in the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatestdetail is the pathway ... o-dianisidine (Sigma) and 10 lgÆmL)1 of MABO. The reaction was initiated by the addition of substrate, and the increase in absorption at 430 nm caused by the oxidation of o-dianisidine was followed...

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... viewpoint and integrated various tasks such as POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model. Feature-based methods (Kambhatla, ... takes about 110 minutes and 30 minutes to do training on the ACE 2003 (~77k training in- stances) and 2004 (~33k training instances) data, respectively. (2) Further Improvement: One of the ... the same subset of the 2004 data, but the 5 parti-tions may not be the same) for the ACE 2004 data. Both corpora are parsed using Charniak’s parser (Charniak, 2001). We iterate over all pairs...

Xem thêm