Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... or Rac1 N17 on nuclearaccumulation of Unkempt (not shown).However, taken together, these data support the ideathat Rac and Unkempt can translocate in the nuclearcompartment and activate BAF60b ... arises of the cellular compartment where this process takes place. Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b, as well as BAF6 0a and BAF60c, were ... Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein...

Báo cáo khoa học: Prediction of coenzyme speciﬁcity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc

... are Mycobacterium tuber-culosis (185 proteins) and Chlamydophila caviae (13proteins), while in archaea the top and bottom is rep-resented by Haloarcula marismortui (146 proteins) and Nanoarchaeum ... In Thermoplasma volcanium,Pyrococcus horikoshii, Thermococcus kodakaraensis,Candida glabrata and Yarrowia lipolytica, the Ross-mann proteins are two to three times more redundantthan proteins ... coenzymebinding proteins can be lost either during the databasesearch or during the classiﬁcation. Only two FAD-bindingproteins are lost (false negatives): one is classiﬁed asNADP-binding and the other is...

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by ﬂuorescence resonance energy transfer and the role of ATP hydrolysis pptx

... strand exchange assay weresynthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAGGGTAATAAGAACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and ... 5¢-CGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGACAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. Phi-C and Phi-W were complementary to each other. Phi-C waslabeled ... Kumbhakar2, Haridas Pal2, Basuthkar J. Rao3 and Jayashree K. Sainis11 Molecular Biology Division, Bhabha Atomic Research Center, Mumbai, India2 Radiation Chemistry and Chemical Dynamics...

Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the ﬁnal step pptx

... of the peptidase to hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason-able rates clearly indicates exclusive cleavage of the anilidebond of Ala-Ala-Val-Ala-pNA. ... exhibiting precisely the sequence of FRAP-TGase.Yellowing of the Ala-Ala-Val-Ala-pNA solution must be the result of direct cleavage of the anilide bond. Ala-pNA and Ala-Ala-pNA were not substrates (or ... 48Pro-Leu-Gly-pNA 199 4.6Ala-Ala-Phe-pNA 86 2.0Suc-Ala-Ala-Phe-pNA < 1 < 0.05Val-Leu-Lys-pNA 5 0.1Cbz-Pro-Phe-Arg-pNA < 1 < 0.05Ala-Ala-Val-Ala-pNA 46 1.1Ala-Ala-Pro-Leu-pNA < 1...

Báo cáo khoa học: Efﬁcient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc

... toward cleavage of the GUC665containingsequence) is 5¢-CGGTTCGAAACCGGGCACTACAAAAACCAACTTTGCCCTGCCCCCTGATGAGGCCGAAAGGCCGAAACTTGCCCCTGGTACCCCGGATATCTTTTTTTCTATCGCGTCGACCT-3¢ and the templateencoding ... (targeted toward CUC825containingsequence) is 5¢-CGGTTCGAAACCGGGCACTACAAAAACCAACTTTCACCCTTCCGCTGATGAGGCCGAAAGGCCGAAAGGTCCCGGTGGTACCCCGGATATCTTTTTTTCTATCGCGTCGACCT-3¢. The ribozymetemplates ... cleavages is a 39–43-amino acid b-amyloid peptide. The major cleavageproducts are Ab40 and Ab42. According to the amyloidhypothesis, accumulation of Ab in the brain is the primaryinﬂuence driving AD...

Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

... Kun Zou1, Wataru Araki3, Chiaki Tanabe1, Naoko Yagishita4,Yoshihisa Yamano4, Tetsuya Amano4, Makoto Michikawa2, Toshihiro Nakajima4,5,6 and Hiroto Komano11 Department of Neuroscience, ... ofJapan, and by a grant from the Ministry of Health,Labor and Welfare of Japan. We thank Dr Paul Lang-man for assistance with the English.References1 Selkoe DJ (2002) Deciphering the genesis and ... 313, 538–550.19 Yamasaki S, Yagishita N, Sasaki T, Nakazawa M,Kato Y, Yamadera T, Bae E, Toriyama S, Ikeda R,Zhang L et al. (2007) Cytoplasmic destruction of p53by the endoplasmic reticulum-resident...

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... formation at the terminator site. When the adjacent uracil-rich sequence is being transcribed, the affinity of the dA–U base pairs is insufficient to stabil-ize the DNA–RNA duplex, and the transcript,together ... (Bc-Csp) and Thermotogamaritima (Tm-Csp). The peptide chains of the CSP arearranged as five antiparallel b strands, separated byfour loops and folded into a closed b barrel [21]. Thisfold belongs ... and hydrophilic areas, respectively.Structural organization of the ligand The dT6ligand adopts an extended, irregular confor-mation. Looking from the protein surface towards the ligand, the...

Báo cáo khoa học: Expression of MsPG3-GFP fusions in Medicago truncatula Ôhairy rootsÕ reveals preferential tip localization of the protein in root hairs pot

... completeplant transformation and has the advantages of stabletransgenic material over transient assays, in which damageoften occurs during DNA incorporation and for whichthere is variability in the ... 5¢-CCCCGGGAGTGAAAAAAGCAAAGTTCAAC-3¢; SPS-2 (105):5¢-CCCCCATGGCTCCTCCAAATGATTTTATATC-3¢. The underlined sequences indicate the EcoRI (5038),BamHI (PG3B), NcoI (EPS-1 and SPS-2) and SmaI (SPS-1)restriction ... this work were:5038 ()12): 5¢-CTAAGAATTCACATGGATAGGAAA-3¢; PG3B (1984): 5¢-GGGGATCCGCTTCTGCTGCAGTTGTGC-3¢;EPS-1(72):5¢-CCCCATGGCTAATATCTTTGATATAAA-3¢;EPS-2(49):5¢-CCACCAGGATTGGGACCACGCC-3¢;SPS-1()33):...

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... Eachapproach has its advantages, and the choice of whichto employ will largely depend on the available startingenzyme and the extent of existing structural and mech-anistic characterization ... between His138 and glyphosate and activation of the substrate amine. This substrate-assisted proton transfer mechanism is consistent with the observed pH dependence of kcat, and explains the dual ... case of Conyzacanadensis, glyphosate accumulates in vacuoles of resis-tant plants at a markedly faster rate than in sensitiveplants [61]. Analysis of the transcriptome of resistant and sensitive...

Tài liệu Báo cáo khoa học: Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability transition pdf

... normalize for loading.Statistical analysisAll values are expressed as mean ± standard deviation.Statistical signiﬁcance was determined using a one-wayHSS and mitochondrial permeability transition ... and apoptosis [41,44].Apoptosis is a genetically predetermined mechanismthat may be activated by several molecular pathways. The best characterized and the most prominent path-ways are the extrinsic ... 24 h and harvested fordetermination of the intracellular ATP level, the caspase-3 activity, and the cytochrome c (Cyt c) level. (A) Intracellular ATP level. The ATP level was measured as described...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf lam the nao de tom tat bao cáo khoa hoc báo cáo khoa học báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật