Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme speciﬁcity of the wild-type enzyme docx

... Re-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme Marina ... kinetic analysis The coenzyme specificity of the mutant enzymes wasinitially assessed using the best available commercial coenzymes without further purification. Values of kcat,Km and kcat⁄ ... Km and the 0.3% NAD+contamination in 1 mm NADP+is far below Km.Nevertheless, a rate  1 ⁄ 200 of the rate in a standardNAD+reaction may be anticipated. A detailed re-analysis of the...

Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx

... onsHsps using bovine a- crystallin to stabilize partially dena-turedproteinsduringreactivationinanATP-dependentmanner [24] and indicating the involvement of ATP in substrate release [25]. In this ... alignment of recombinant MTB HSP 16.3 and recombinan t hum an aB-crystallin. Amino-acid sequence a lignment between recombinant MTB H SP 16.3 and h uman aB-crystallin wasaligned using the MULTALIN ... separatereports, ATP increased the refolding of xylose reductase bytotal a- crystallin [34], increased the binding of a- crystallin tolens membranes, and inhibited the chaperone activity of a plant sHsp...

Báo cáo khoa học: Deﬁnition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx

... their roles in controllingacid secretion and as growth factors in the gastrointestinal tract. Severallines of evidence, including the facts that transferrin binds gastrin, thatgastrins bind ferric ... complex, EDTA wasinjected into the BIAcore to chelate any available iron.As soon as the EDTA was injected, the association between gastrins and ApoTf was disrupted, indicatingthat ferric ions ... [12] and Gamide [13].To characterize the involvement of the glutamates in the interaction of the peptide with ApoTf, Gglymutants in which alanine was substituted for glutamate at positions 7 and...

Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

... 295 1A GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC2951B GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC2951C AGGAAGGCCGGCAAATGGC2951D TTCACGTGAGATAAGCTCCC2951E ACGGTTTCGGTGAAGCCAG2951L ACAATTAATTAACAGTATGTACGAGCGATGCG2951M ... ACAATTAATTAACAGTATGTACGAGCGATGCG2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTGppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGCppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGCppsE3 CGTTCTGGAGCAACCTTCGppsE4 GGTCGAGGAAGTACGTGACres ... GCTCTAGAGCAACCGTCCGAAATATTATAAAres2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATCPhthiocerol dimycocerosates in M. tuberculosis R. Sime´one et al.1966 FEBS Journal 274 (2007) 1957–1969 ª 2007 The Authors...

Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx

... particularly involving the N-terminus of the peptide. These interactions may increase the stability and binding affinity and play important roles in bind-ing specificity. Similar electrostatic interactions ... atoms of H68, L429 and Y77 in strand b4, and between P431 and the aliphatic part of Q80 side chain in the loop connectingstrands b4 and b5.As mentioned above, conserved Q234 in nNOS and other ... glutamine that is the usual hallmark of DYNLL1 binding sequences, yet binds to DYNLL1 at the same binding site and in similar fashion. A hierarchy in the binding affinity of DLC8 targetshas been...

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identiﬁcation of RGD/KGE sequences as binding motifs for C2 domains pdf

... blotting analysis using an antibody raisedagainst cabbage PLDa that cross-reacted with our90-kDa cardosin A- binding protein (Fig. 1B). After the identification of cardoon PLDa as a cardosin A- binding ... cardosin B was tested in the binding assays with PLDa (Fig. 4B), confirming the specificity of the interaction between PLDa and cardo-sin A. A characteristic feature of plant PLDa is the C2domain at ... protein after preincubation of the antibody against recombinant cardosin A with nativecardosin A (Fig. 2B).Molecular cloning of C. cardunculus L PLDa cDNA and characterization of the deduced amino-acidsequenceTo...

Báo cáo khoa học: An extension to the metabolic control theory taking into account correlations between enzyme concentrations potx

... resources, the energeticcost of maintaining the cellular concentrations of enzymes[25–27], and the availability of amino ac ids or elements o f the transcription and translation machinery, which has ... analyse in detail the particular case of a linearpathway of enzymes far from saturation, considering the response of both ﬂux and metabolite concentrations.Linear models of redistribution of ... y,suchas the ﬂux in the pathway or the concentration of a metabolite, toan in nitesimal change in the activity (concentration) of enzyme Ek, Kacser & Burns [1] and Heinrich & Rapoport...

Báo cáo khoa học: Redox reaction between amino-(3,4-dihydroxyphenyl)methyl phosphonic acid and dopaquinone is responsible for the apparent inhibitory effect on tyrosinase doc

... reaction it wasaccompanied by a steady increase of absorbance at 320 nm,where the absorption maxima of dopachrome and 3,4-dihydroxybenzaldehyde overlap. At the same time the increase of absorbance ... dopachrome.Changes in the UV/Vis spectra of a mixture of compound 1 and Dopa oxidized by tyrosinase indicated that this wasindeed the case (Fig. 3C). In the initial phase of the reactionFig. 3. Spectral changes ... 3-(3,4-dihydroxyphenyl)alanine (Dopa) assubstrates, respectively). Neither was the enzyme covalentlyinactivated to a signiﬁcant degree. Spectroscopic and elect-rochemical analysis of the oxidation of a mixture of...

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... much turmoil regarding the ‘lifeis sacred at any cost’ maxim [1]. Current technology iscapable of indiscriminately maintaining some of the vitalfunctions of the body, but the same technology ... notnecessarily allow us to heal underlying disease processes [2].An unintended side effect of modern technological advanceshas been the plausibility of maintaining moribund patients in a state of ... suspended animation; they arenot alive in the sense the we enjoy life but neither are theyable to die as long as nutrition, hydration, ventilation, and perfusion are assured. In many cases reanimation...

Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in ﬁsh pdf

... 7,3.52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, HamaguchiS, Sakaizumi M & Nagahama Y (2007) DMY geneinduces male development in genetically female ... abundant dmrt1 expression duringpreparatory and prespawning and spermatogenesisperiods was seen, in contrast to a gradual decreasethereafter during spawning ⁄ spermination. This indi-cates that ... sex-reversalmutants in the medaka, Oryzias latipes. Genetics 173,2083–2090.12 Otake H, Masuyama H, Mashima Y, Shinomiya A, Myosho T, Nagahama Y, Matsuda M, Hamaguchi S &Sakaizumi M (2009) Heritable artiﬁcial...

Xem thêm

Từ khóa: báo cáo tóm tắt thành tích tập thể phân tích báo cáo lưu chuyển tiền tệ như thế nào mẫu báo cáo tóm tắt thành tích tập thể báo cáo về thị trường may mặc thế giới báo cáo về thị trường cà phê thế giới báo cáo về thị trường lương thực thế giới Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM