Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... is length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... Creating a Multilingual Collocation Dictionary from Large Text CorporaLuka Nerima, Violeta Seretan, Eric WehrliLanguage Technology Laboratory (LATL), Dept. of LinguisticsUniversity of GenevaCH-1211...

Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... corpusRyo NagataKonan University8-9-1 Okamoto,Kobe 658-0072 Japanrnagata @ konan-u.ac.jp.Edward Whittaker Vera SheinmanThe Japan Institute forEducational Measurement Inc.3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004;Nagata et al., 2005; Nagata et al., 2006; Tetreault etal., 2010b). This is one of the most active researchareas in natural language processing of learner ... NorthAmerican Chapter of the ACL, pages 154–162.Joel Tetreault, Elena Filatova, and Martin Chodorow.201 0a. Rethinking grammatical error annotation andevaluation with the Amazon Mechanical Turk....

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... markers, we do not regard this distinction as particularly helpful, though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic ... that the proper place for describing discourse markers is a dedicated lexicon that provides a classification of their syntactic, semantic and pragmatic features and characterizes the relationships ... summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furthermore it catches...

Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

... perfor-mance of WSD algorithms for languages such asEnglish for which hand-crafted sense-annotatedcorpora have been available (Agirre et al., 2007;Erk and Strapparava, 2012; Mihalcea et al., ... the amount of data that canreasonably be annotated by hand.Leacock et al. (1998), Agirre and Lopez de La-calle (2004), and Mihalcea and Moldovan (1999)propose a set of methods for automatic ... be language inde-pendent and should be applicable to as manylanguages as possible for which the neces-sary input resources are available.(2) The quality of the automatically generateddata...

Tài liệu Báo cáo khoa học: Leptin protects H9c2 rat cardiomyocytes from H2O2-induced apoptosis docx

... medium, and ana-lyzed by confocal microscopy.Caspase-3 activity assayCaspase-3 activity was measured using an Apo-ONE homo-geneous caspase-3 assay kit (Promega, Madison, WI, USA)according ... blotting was conducted using nih image software(National Institutes of Health, Bethesda, MD, USA).Statistical analysisAll data presented are expressed as means ± SEM. Sta-tistical analysis was undertaken ... in total cas-pase-3 levels (35 kDa) were analysed bywestern blotting. (B) Quantitative analysis ofthe activity of caspase-3 measured using a speciﬁc caspase-3 activity assay kit (mean-s ±...

Tài liệu Báo cáo khoa học: "AUTOMATIC ACQUISITION OF SUBCATEGORIZATION FRAMES FROM UNTAGGED TEXT" doc

... sufficiently large corpora and sufficiently cheap computation have become available. Three recent papers in this area are Church and Hanks (1990), Hindle (1990), and Smadja and McKeown (1990). The latter ... paper describes an implemented program that takes a raw, untagged text corpus as its only input (no open-class dictionary) and gener- ates a partial list of verbs occurring in the text and ... immediately to the right of a main verb. Adverbs and adverbial phrases (including days and dates) are ignored for the pur- poses of case adjacency. A noun-phrase that sat- isfies the Case Filter...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-speciﬁc...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... view from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identiﬁcation of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... factor.Thus, TransLISA can replace EMSAs and may be used in various applica-tions and research ﬁelds where quantitative, cost-effective and large- scalemeasurements of the DNA-binding activity of transcription...

Xem thêm