Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal1, Daniel Kolarich 2 , Kay Foetisch1, Iris Lauer1, Friedrich Altmann 2 , ... biological activity of allergens.Keywords: Lyc e 2; tomato; food allergen; IgE reactivity;glycoprotein.To date, only few attempts have been made to identify and characterize tomato allergens. ... peroxidase,deglycosylated horseradish peroxidase, the glycopeptideMUXF and MUXF conjugated to BSA as well as BSAalone were used. The histamine releases were measured byan enzyme immunoassay...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... until all free waterwas evaporated. After this, IR spectra were recorded atroom temperature and at 37 °C. Usually, the originalspectra were evaluated directly and a spectral analysis wasperformed ... analysis [23 ] wereperformed. 327 2 K. Brandenburg et al. (Eur. J. Biochem. 27 0) Ó FEBS 20 03Aggregate structures and molecular shapeFor the determination of the three-dimensional supra- molecular ... diffrac-tion peaks. The shape of the main reﬂection band locatedbetween 0.1 and 0.3/nm can be interpreted by the existence of a unilamellar structure. The location of the four smallpeaks superimposed...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ... Quik-Change Site-Directed Mutagenesis Kit (Strategene). Theprimers used were: 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) ... (reverse) to APUM -2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ (reverse) to APUM-7.Qualitative and quantitative b-galactosidadeactivity...

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-CATGG-3¢ were used for detecting ... that for actin mRNA. Values were calculated as a percentage of the highest value obtained during maturation. Datarepresent the mean ± standard deviation of four experiments.K. Iwasaki et al. ... GmPDIL-3b were resistant to proteasetreatment in the absence of detergent, and weredegraded when detergent was added (Fig. 4B), suggest-ing that they are both luminal proteins.Generally, PDI family...

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... polymerase activity on metal ions. The results are the means of three independent experiments. (C) The dependence of polymerase activity on the temperature was determined by assaying the enzyme ... as described in Experimental procedures.Reaction products were separated on 20 % polyacrylamide ⁄ ureagels and radioactivity was detected by autoradiography. Lanes 1–4 of each gel were loaded ... multifunctional nature, archaealDNA primases share a number of features with eukar-yal ones and are consequently subsumed within thesuperfamily of structurally related proteins calledarchaeo-eukaryotic...

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebraﬁsh (Danio rerio) doc

... betweenhelices H1 and H2, and 84 residues instead of 10 resi-dues between helices H2 and H3 (Fig. 2) . Molecular characterization of zebrafish PrP1The imperfect match obtained on Ensembl zebrafishgene GENSCAN00000038006 ... p.babin@gpp.u-bordeaux1.frNoteThe sequence data presented here havebeen deposited with the GenBank ⁄ EMBLData Libraries under the accession numbersAJ85 028 6 for zebrafish PrP1 and AJ 620 614for zebrafish PrP2 mRNAs.(Received ... tohindbrain along the bilateral symmetry axis. The labe-led specialized large and elongated cells of the anter-ior part of the floor-plate were positioned at the base of the commissure separating...

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... clinical setting, because theoveruse and misuse of antibacterial agents have resul-ted in the emergence of antibiotic-resistant strains [5].Therefore, the alarming rise of antibiotics resistanceamong ... 2- ( {2- [ (2- { [2- (2, 3-dimethylanilino) -2- oxoethyl]sulfanyl}-1,3-benzo-thiazol-6-yl)amino] -2- oxoethyl}sulfanyl)-N- (2- naphthyl)acetamide (4) and maesaquinone diacetate (5) wereTable 1. Comparison of kinetic parameters of SDH enzymes fromvarious bacteria. a Kinetic parameters ... novel antibacterial targets [8,9]. At thesame time, comparison of bacterial target genes withhuman genes will also be necessary because, to avoidadverse effects, a good antimicrobial drug targetshould...

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... thedefense of pathogens, isolation and characterization of cytokines is of prime importance. Only a few cytokines and chemokines are known in ﬁsh, where they have been clonedeither by expressed sequence ... forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ATTTAGGTGACACTATAGAAFig. 1. Genomic sequence structure of carp IL-10. Coding sequences ... Hydropathy analyses of carp,torafugu and human IL-10 amino acid sequences werecarried out [22 ]. Phylogenetic analysis was carried out forthe deduced amino acid sequences of carp and other IL-10homologues....

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... 6-well platesfor reading in a microplate ﬂuorescence analyzer. Values are showed inthe percentage i nhibition of peptide-treated cells and expressed as themean of three independent experiments. 28 78 ... ﬁveor more SRBCs bound were counted as rosettes. At least 20 0 cells werecounted to determine the percentage of E- rosette cells. Values arepercentage inhibition of peptide-treated cells and expressed ... positions of peptides were generated at three sites on CD58 proteinsurface (Fig. 2A) . The parameters were set as the defaultvalues of theAUTODOCKLamarckian genetic algorithm.First, a randomized...

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... obtained was corrected bymanual inspection, and unambiguously aligned 1 82 siteswere selected and used for phylogenetic analysis. Data ﬁlesfor the original alignment and selected sites are availablefrom ... the enteric protozoanparasite Entamoeba histolytica was characterized. The E. histolytica PGDH gene (EhPGDH) encodes a protein of 29 9 amino acids with a calculated molecular mass of 33.5 kDa and ... conversions between Asp and Asn and between Glu and Gln [49]. Serine metabolic pathwaysare often absent in parasitic protists; the majority of theseprotists, as mentioned above, apparently lack...

Xem thêm