0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

... CW, Malapeira J, Colome N, Moss M,Canals F & Arribas J (2008) Metastasis -associated C4. 4A, a GPI-anchored protein cleaved by ADAM10and ADAM17. Biol Chem 389, 1075–1084.60 Janes PW, Saha N, ... Colciaghi F, Marcello E, Borroni B, Zimmermann M,Caltagirone C, Cattabeni F, Padovani A & Di LM(2004) Platelet APP, ADAM 10 and BACE alterationsin the early stages of Alzheimer disease. ... Gutenberg-University, Mainz, GermanyIdentification of ADAM10 as a functional a- secretase A disintegrin and metalloproteinase 10 (ADAM10)originally came into focus in genetical and biochemicalresearch as a peptide...
  • 12
  • 591
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCTGTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGGATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢-CGCGGATCCACCGTAGACACTTATGATATA-3¢ and5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢;rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGTGATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; ... the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa H (2002) Fish otolith contains a unique...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... hallmark of cancer cells is a deregulation of cellular proliferation [55]. The assess-ment of cellular proliferation in histological material is a valuable component of conventional histopathologi-cal ... reactive with a human nuclear antigen associated with cell prolifer-ation. Int J Cancer 31, 13–20.27 Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U &Stein H (1984) Cell cycle analysis of a cell ... histologi-cal sections. The antibody was tested on formalin-fixedparaffin-embedded normal human skin sections as wellas on invasive-lobular mamma carcinoma and small cell bronchial carcinoma...
  • 16
  • 504
  • 0
Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx

Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx

... mtDNAmutations associated with Leber’s hereditary opticneuropathyMaura Floreani1, Eleonora Napoli1,2, Andrea Martinuzzi2, Giorgia Pantano2, Valentina De Riva2,Roberta Trevisan1,2, ... MnSOD and CuZnSOD proteins arepossibly upregulated as a compensatory mechanism,but may be partially inactivated by oxidative damage.Complex I impairment in a variety of human diseaseshas been ... Ghelli A, Zanna C,Baracca A, Lenaz G, Napoli E, Martinuzzi A & SolainiG (2004) Bioenergetics shapes cellular death pathwaysin Leber’s hereditary optic neuropathy: a model ofmitochondrial...
  • 12
  • 548
  • 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... TAT ATG T Weak 3 aa2 ⁄ 4 55067 TCA ATG C Weak 58 aa3 33 39% 609296093360939GTA ATG CTGC ATG TTCC ATG GGAdequateWeakAdequate13 aa33 aa31 aa3¢ 76 49% –4¢ 56 61% 61041 GGA ATG T Adequate ... obviousretrieval signal is missing.The human phospholipases D1 and D2 are mainly associated with the plasma membrane or with themembranes of intracellular organelles although theylack a transmembrane ... one, a strong con-text both [13].PositionKozak consensus A GCC ATG GGContextATG1330 AAG ATG A AdequateATG2345 CTG ATG T WeakATG3396 CCC ATG A WeakATG4489 CTG ATG A WeakHu-K4 A. ...
  • 9
  • 518
  • 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... 2717 KIPase activity is a novel caspase-like activity associated with cell proliferation Cahora Medina-Palazon, Emmanuelle Bernard, Victoria Frost, Simon Morley and Alison J. SinclairBiochemistry Department, ... substrate for caspase 1;Ac-IETD-AMC is a substrate for caspase 8 and 10;Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9.Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMCare tetra peptide substrates representing ... active caspase 3 [38].Because KIPase cleaves a subset of caspase substrates, wequeried whether KIPase is associated with apoptosis. In allcases apoptosis was measured by comparing the percentageof...
  • 8
  • 442
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutagenesis.Desired mutation Template gene Constructed mutant Primer sequence (5¢-to3¢) Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... best case, because an oxidativedegradation of the catalyst occurred. This was shown by a progressive disappearance, in its absorption spectrum, ofthe soret band at 396 nm that is characteristic ... abzymes; nitrosoalcanes;microperoxidase 8; S-oxidation.Catalytic antibodies with a metalloporphyrin cofactor, orÔhemoabzymesÕ, are not as efficient a category of catalysts astheir natural hemoprotein ... counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues that are three to four orders of magnitudelower than those for natural peroxidases [1]....
  • 7
  • 447
  • 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... Gram-positive bacteria [36], a signal peptideof 70 amino acids is not in agreement with this multi-variate data analysis. Therefore, the simplest explan-ation would be that the N-terminus of the mature ... pneumoniae,although a SPase I activity has been shown to beessential for cell viability in all bacteria analyzed [26].To test experimentally whether there is a type ISPase activity in M. pneumoniae, ... N-terminalpart of the peptide, it is evident that the N-terminalamino acid is asparagine (position 26), but increasedin mass by 136 Da. Because this modification is onlypossible at the free a amino...
  • 9
  • 559
  • 1
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

... via a separate cADPR binding protein. In addition to Ca2+release, cADPR also evokes Ca2+entry. The underlying mechanism(s) maycomprise activation of capacitative Ca2+entry and ⁄ or activation ... from NAD byCD38-type ADPRC and which is also a breakdownproduct of cADPR (Fig. 2). TRPM2 is a Ca2+- andNa+-permeable cation channel that is mainlyexpressed in the brain and in cells of ... ofCa2+channels, either localized in the membranes ofintracellular Ca2+stores or in the plasma membrane.Such Ca2+entry channels in the plasma membraneand Ca2+release channels in intracellular...
  • 8
  • 469
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP