Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme Tomohiko Gohya1, Xuhong Zhang2, Tadashi Yoshida2 and Catharina T. ... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data notshown). The estimated association constants for imi-dazole and azide binding to heme GmHO-1 are sum-marized and compared...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ( 1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 ... containing PHD domain;unknown functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 ( 1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... Wellenreuther and W. Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conﬂict of this ﬁnding with the absence of a coordinating carboxylate...

Tài liệu Báo cáo khoa học: Kinetic characterization of the ﬁrst step of the ribozyme-catalyzed trans excision-splicing reaction docx

... 0.01Æmin )1 ) the chase are the average of two independentassays. All data points between the two independent assays have a standard deviation < 10%. From this data, the rate of substratedissociation, ... mM guanosine, 10 mM MgCl2,50 mM Mes (pH 7) and substrate (5¢-G2CCCUCUAAAAA-3¢)at50°C[6].cSubstrate-cleavage reaction (exogenous guanosine-mediated) of the substrate (5¢-CUUAAAAA-3 ) using ... from these plots and are the average of two independent assays. All data points between the two independent assays have a standard deviation < 15%.(C) Non-linear least squares ﬁt to the Michaelis–Menten...

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... respectively[39]. The structure- based calculations provide a DCp of )4 07 calÆmol )1 ÆK )1 and DASAapolar and DASApolar of )1 354 and )7 77 A ˚2, indicating that more of the apolarresidues are buried on complex ... program[41]. The DCpwas calculated using the following equa-tion:DCp¼ 0:45DASAapolarÀ 0:26 ASApolarwhere DASAapolar and DASApolarare the changes inASA of the apolar and polar residues, ... experimental thermodynamic parameters and structure- based calculated parameters based on sur-face area parameterization. This approach is clearlyan approximation; according to this parameterization,the...

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... spectrometry and assigned to be free CoA(peak 1), acetyl-CoA (peak 2) (Z)-3-MG-5-CoA (peak 3) (E)-3-MG-5-CoA (peak 4) and (E)-3-MG-1-CoA (peak 5). The determined relative molec-ular masses (MW) of the ... oligonucleotides AUHFW 5¢-AGCTCATATTCTCTGTGCGAGTCCTCGATGGC-3¢ and AUH RP 5¢-GCCATCGAGGACTCGCACAGAGAATATGAGCT-3¢ (the c.719C>T mutation leadingto the amino acid exchange A2 40V is underlined). The AUH ... (199 9) Characterisation and mitochondrial localisa-tion of AUH, an AU-speciﬁc RNA-binding enoyl-CoAhydratase. Gene 228, 85–91.17 Nakagawa J & Moroni C (199 7) A 20-amino-acidautonomous RNA-binding...

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTGGGATCCGTGACTCGAGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCGACTTATCGCACACTATAGCTTGATG-3¢ as primers(restriction sites are underlined ... isopentenyl diphosphate isomerases were found in the genomes of Archaea and of certain eubacteria but not in the genomes of fungi, animals and plants. The analysis of the occurrence of idi-1 and idi-2 ... and the Thermococcales together with the Methanobacteriales (bootstrap value: 77 %) are groupedinto clusters. The presently available data suggest that Cyano-bacteria, Bacillales and Lactobacillales...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... h and then cut with ClaI (C and D).DNA was separated by electrophoresis on an agarose gel and the ethidium bromide ﬂuorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... mitoDC-81 alkylates mtDNA in mitochondria or cells. The reasons for the lack of alkylation of mtDNAwithin mitochondria by mitoDC-81 are unclear. The localconcentrations of mitoDC-81 and DNA, and the ... present and was independent of the size of the DNAfragment (Fig. 3A, lane 1). As mtDNA in vivo is negativelysupercoiled it was also important to compare the ability of mitoDC-81 to alkylate linear,...

Tài liệu Báo cáo khoa học: Reductive nitrosylation of ferric human serum heme-albumin docx

... 5.5 and 7.5, and at 20 °C. (A) Normalized averaged time course of HSA -heme- Fe(II) nitrosylationat pH 5.5 (trace a) and 7.5 (trace b), and at 20 °C. The time course analysis according to Eqn ( 6) ... 104m )1 Æcm )1 . The optical absorptionspectra of HSA -heme- Fe(II) and HSA -heme- Fe(II)-NOTable 1. Values of thermodynamic and kinetic parameters for reductive nitrosylation of HSA -heme- Fe(III), at ... concentration (i.e. [NO ]). The analy-sis of data according to Eqn ( 2) allowed the values of kon(= 1.3 · 104m )1 Æs )1 ) and koff(= 2.0 · 10 )1 s )1 ) to be determined, at pH 5.5 and 20 °C (Table...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... found to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involvedin ... (B)Macula (M) and transitional epithelial (TE) regions. Intense hybridiza-tion signals were observed in the cells at the periphery of the mac-ula (arrowhead) and in transitional epithelial ... to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T (200 0) Molecularmechanism of the nacreous layer formation in Pinctadamaxima. Biochem...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vv báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptx tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh báo cáo khoa học về nghệ thuật trong lieu trai chi di tai lieu bao cao thuc tap tai khoa duoc benh vien hop luc đề tài báo cáo khoa học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ