Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... cerevisiae, is classified as a member of the phos- phatidylethanolamine -binding protein family. The binding of I C to phos- pholipid membranes was first analyzed using a liposome -binding assay and by ... Crystallization and preliminary X-ray analysis of carboxypeptidase Y inhibitor I C complexed with the cognate proteinase. Acta Crystallogr D 60, 1622–1624. J. M...
Ngày tải lên : 19/02/2014, 05:20
  • 10
  • 645
  • 1
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... loose a ssociation for the peptide in the membrane bilayer. Self-assembly can also b e analyzed by compositional variation of rhodamine-labelled p eptide, keeping the total concentration of labelled ... sample, the 45° germanium ATR-plate (2 · 5 · 50 mm) was cleaned by a plasma cleaner (Harrick, Ossining, N Y, USA). Analysis of ATR-FTIR data was performed in accordance w...
Ngày tải lên : 19/02/2014, 16:20
  • 12
  • 589
  • 0
Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf

... 789 11615141312111023456789 B A CGGCCC +RNA0 – +RNA1 +RNA2 +RNA3 +RNA4 +RNA5 C – –RNA1 –RNA2 –RNA3 –RNA4 –RNA5 CGGCC +RNA1 CGGC +RNA2 CGG +RNA3 C +RNA4 +RNA5 ACCTCGTATAC –RNA0 ACCTCGTATA –RNA1 ACCTC –RNA2 ACC –RNA3 AC ... condition of a fixed amount of the NS5B and the radiolabeled +RNA0 in the presence of increasing a mount of competitor, the unlabeled +RNA0. The EMSA...
Ngày tải lên : 19/02/2014, 16:20
  • 9
  • 560
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... 239r TAATACGACTCACTATAGGGGCACGCCCAAATCTC 239 5’S2 GCCAGCCCCCTGATGGGGGCGA (–)IRES 219r AAA TAATACGACTCACTATAGGCATTGAGCGGGTTTATCC 219 5’S2 GCCAGCCCCCTGATGGGGGCGA (–)IRES 104r AAA TAATACGACTCACTATAGACACTCATACTAACGCCATG 104 ... 5’341T7 TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT (–)IRES DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG DSLA1 5’341T7 TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT (–...
Ngày tải lên : 20/02/2014, 01:20
  • 15
  • 597
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760–763. 31 Vagin A & Teplyakov A (2000) An approach to multi- copy search in molecular replacement. Acta Crystallogr D Biol Crystallogr ... Using a thermal-melt assay, a nucleo- tide metabolome library was screened against PRTFDC1 and revealed that hypoxanthine and guanine specifically interacted with the enzyme....
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACE Zf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACE Zf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... the catalytic activity of OTUB1 and its ability to stabilize the active form of RhoA prior to invasion. YpkA and OTUB1 modulate the stability of RhoA in opposing ways, therefore leading to cytoskeletal ... and demonstrate a physiological role of the deubiquitinat- ing enzyme OTUB1 in Yersinia invasion. OTUB1 as a potential key player in regulating RhoA stability may repres...
Ngày tải lên : 16/02/2014, 15:20
  • 16
  • 654
  • 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

... taken from [44]. Chicken H101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNK H110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNK H102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNK H103 a- A pTAAPA AK A K A K ATK ... DK H1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aK H1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afK H1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a...
Ngày tải lên : 18/02/2014, 08:20
  • 13
  • 633
  • 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... synthesis Squalene Cholesterol HMG-CoA reductase SREBP-2 NADPH Pyruvate Acetyl-CoA Citrate acetyl-CoA Oxaloacetate Oxaloacetate ACL ACC HMG-CoA HMG-CoA synthase Citrate Malonyl-CoA Palmitate Malate Mitochondria FAS ACC SCD Fatty ... dehydrogenase; PK, pyruvate kinase; ME, malic enzyme; ACL, acetyl-CoA lyase; ACC, acetyl-CoA carboxyl- ase; FAS, fatty acid synthase; SCD, stea- royl-CoA desatura...
Ngày tải lên : 18/02/2014, 13:20
  • 6
  • 574
  • 1
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... T, Maruy- ama M, Saito M, Yamada M, Takahashi H & Tsuji S (1999) A neurological disease caused by an expanded CAG trinucleotide repeat in the TATA -binding protein gene: a new polyglutamine ... by the fact that an aberrant version of TBP cau- ses spinocerebellar ataxia [40] and the lack of TBP by homologous recombination leads to growth arrest and apoptosis at the embry...
Ngày tải lên : 19/02/2014, 07:20
  • 12
  • 511
  • 0

Xem thêm

Từ khóa: