Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... antibody on formalin-ﬁxed andparafﬁn-embedded tissues (Fig. 9). Antibodies againstPCNA and Cdc45 stained malignant cells in a compar-able manner, e.g. on invasive-lobular mamma carci-noma sections ... in histological material is a valuable component of conventional histopathologi-cal analysis and may be of major prognostic import-ance [56]. Proliferation in immunohistochemicalsections can ... the analysis of human Cdc45 protein levelsduring the mitotic cell cycle and in various nonprolifer-ating states. Our data highlight that Cdc45 is a prolif-eration-associated antigen that becomes...

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... Hill RoadPalo Alto, CA 94304, USAmforst@parc.comAbstractIn this paper we present a human- basedevaluation of surface realisation alterna-tives. We examine the relative rankings ofnaturally ... European Chapter of the ACL, pages 112–120,Athens, Greece, 30 March – 3 April 2009.c2009 Association for Computational Linguistics Human Evaluation of a German Surface Realisation RankerAoife ... string accuracy, gener-ation tree accuracy, word accuracy (Bangalore etal., 2000; Callaway, 2003; Nakanishi et al., 2005;Velldal and Oepen, 2006; Belz and Reiter, 2006).It is not always clear...

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... substrate for caspase 1;Ac-IETD-AMC is a substrate for caspase 8 and 10;Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9.Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMCare tetra peptide substrates representing ... follows: caspase 1, WEHD-AMC; caspase 2, VDVAD-AMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5,WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; ca-spase 8, IETD-AMC; caspase 9, LEHD-AMC; ... IETD-CHO,N-acetyl-Ile-Glu-Thr-Asp-aldehyde; IETD-AMC, N-acetyl-Ile-Glu-Thr-Asp-AMC; LEHD-AMC, N-acetyl-Leu-Glu-His-Asp-AMC;YVAD-AMC, N-acetyl-Tyr-Val-Ala-Asp-AMC; z-VAD-fmk, ben-zoyloxycarbonyl-Val-Ala-Asp(OMe) ﬂuoromethylketone.(Received...

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... TAT ATG T Weak 3 aa2 ⁄ 4 55067 TCA ATG C Weak 58 aa3 33 39% 609296093360939GTA ATG CTGC ATG TTCC ATG GGAdequateWeakAdequate13 aa33 aa31 aa3¢ 76 49% –4¢ 56 61% 61041 GGA ATG T Adequate ... [13].PositionKozak consensus A GCC ATG GGContextATG1330 AAG ATG A AdequateATG2345 CTG ATG T WeakATG3396 CCC ATG A WeakATG4489 CTG ATG A WeakHu-K4 A. Munck et al.1722 FEBS Journal 272 (2005) ... obviousretrieval signal is missing.The human phospholipases D1 and D2 are mainlyassociated with the plasma membrane or with themembranes of intracellular organelles although theylack a transmembrane...

Tài liệu Báo cáo khoa học: "Acquiring Receptive Morphology: A Connectionist Model" pdf

... a partic- ular template. The present template was ClaC2aCaa, the past template aCtC2aaC3, and the future template aClaC2Caa. Thus the three forms for the root pmn were pamana, apmaan, ... following two template morphology rules, involving three forms: (1) present: CzaC2aCaa, past: aCiC2aaC3, future: aClaC2C 3a (2) present: ClaC2Caaa, past: aC1C2aCaa, future: aClaC3aC2. 282 ... portant is the hope that a connectionist network, or a device making use of a related statistical approach to learning, may have the capacity to learn a task such as word recognition without...

Tài liệu Báo cáo khoa học: "GRADED UNIFICATION: INTERACTIVE A FRAMEWORK PROCESSING" pdf

... van, which is inanimate, makes a good Theme but a poor Agent for recognized, the past participial analysis in 2) is reinforced and the main clause (past tense) sup- pressed. Being animate, ... combinatory mechanism in classical constraint-based parsers, is too brittle to withstand this onslaught of uncertainty. This paper presents an extension to classical unification, called graded ... alkim©unagi, cis. upenn, edu Abstract An extension to classical unification, called graded unification is presented. It is capable of combining contradictory information. An interactive...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...

Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc

... potentialas a large-scale source of human IF for analytical andtherapeutic purposes.Keywords: arabidopsis; cobalamin; intrinsic factor; recom-binant.Vitamin B12(cobalamin, Cbl) is the ... recombinant plants for large-scale production ofpathogen-free human recombinant IF. Human IF wassuccessfully expressed in the recombinant plant Arabidopsisthaliana. Extract from fresh plants ... to be an excellent source of IFfor analytical application and, possibly, for therapeuticdevelopment.Materials and methodsPreparation of the genetic material A cDNA for human IF was prepared...

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

... Kagara I, Matsuda R,Toki K, Nishimura H, Chiyomaru T, Tatarano S, Ide-sako T et al. (2007) Nuclear translocation of ADAM-10 contributes to the pathogenesis and progression of human prostate ... bovinebrain myelin membrane preparations [1], and wasreferred to as MADM (i.e. mammalian disintegrin-me-talloprotease). Accidentally, this metalloproteinase wasidentiﬁed via an artifact resulting ... aninteraction partner for ADAM10 that enhances a- sec-retase shedding of APP, probably by regulating matu-ration of the prodomain of ADAM10 [22].The catalytical domain of ADAM10 contains a typical zinc-binding...

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... CBP is a structural platform that is capable of binding severaldifferent families of transcriptional activators [30], andevidence indicates that the KIX domain has the abilityto simultaneously ... generaltranscriptional co-activators that contain histone andtranscription factor acetylation activities [30]. In addi-tion, CBP contains a number of protein-bindingdomains that mediate transcription ... Milne TA, CopelandTD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,Bhattacharjee A, Biondi CA et al. (2004) Meninassociates with a trithorax family histone methyltrans-ferase complex and with...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ