Tài liệu Báo cáo khoa học: Evidence for noncooperative metal

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... formation of the M 4 a cluster prior to formation of the M 3 b cluster, demonstrating that the individual binding constants of divalent metal ions for the a domain are larger than those for the b domain. Further ... elucidate the potentially cooper- ative nature of the metal- binding reaction within each of the domains. Thus, the goal is to e...

Ngày tải lên : 19/02/2014, 00:20

9
533
0

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn 3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... to Ala L2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg...

Ngày tải lên : 19/02/2014, 17:20

15
532
0

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... percentage of G418- resistant colonies obtained by transfecting the established human tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma MDA-MB-231 cells with the anti-(Ras 1) and anti-(Ras ... from the total cellular environment to the huntingtin aggregates and to a higher rate of aggresome formation. Consequently, there is a decrease in proteasome av...

Ngày tải lên : 21/02/2014, 00:20

9
624
0

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... years as a result of the expansion of the Aedes aegypti mosquito to dif- ferent geographic areas, and DHF has spread from South East Asia to the Western Paciﬁc and the Americas. A substantial ... NJ, Yao N, Wright-Minogue J, Zhang R, Ramanathan L, Lau JY, Hong Z & Dasmahapatra B (2000) Hepatitis C NS3 protease: restoration of NS 4A cofactor activity by N-biotinylati...

Ngày tải lên : 19/02/2014, 00:20

17
462
0

Tài liệu Báo cáo khoa học: Fermentative lifestyle in yeasts belonging to the Saccharomyces complex ppt

... duplication took place after the separation of Saccharomyces, Kazachstania, Naumovia, Nakesimia and Tetrapisispora from the rest of Saccharomyces complex genera (Fig. 1). Another problem for comparative ... due to amino acid biosynthesis. Much of the generation of NADH during amino acid biosynthesis takes place in the mitochondria. Because of the block in the respi...

Ngày tải lên : 19/02/2014, 02:20

14
626
0

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... were used for the preparation and ligation of DNA fragments, for the trans- formation of Escherichia coli and for the isolation of plas- mid DNA from bacterial cells [51]. Other yeast genetic methods ... 500 kDa band to the 670 kDa band, a structural rearrangement of the bc 1 complex may occur due to the binding of ISP and Qcr10p, possibly leading to the...

Ngày tải lên : 18/02/2014, 08:20

15
639
0

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... some of the a- amylase family CSRs, namely the b-strands b2, b3, b4 and b8 of the (b ⁄ a) 8 barrel domain, and for rBAT also with the short stretch near the C-terminus of domain B [9,19]. From the ... lizards and frogs (lacking both essential aspar- tates at the b4- and b7-strands) and also from some ﬁshes (lacking the b4-strand aspartate). This may mean that th...

Ngày tải lên : 18/02/2014, 13:20

14
564
0

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... was used for RT-PCR. PCR ampliﬁcation of cDNAs was per- formed with the following primers: 5¢-TCTCTGCTGC CAGACA-3¢ and 5¢-GCCACAGCAGAACAGA-3¢ for HVEM; 5¢-TCCTTCACCGATGGCACTATCC-3¢ and 5¢-TCAACACCAGCAGGATGCTC-3¢ ... and 5¢-TCAACACCAGCAGGATGCTC-3¢ for nectin-1; and 5¢-AGAAGCAGCAGCACCAGCAG-3¢ and 5¢-GTCACG TTCAGCCAGGA-3¢ for nectin-2. The 3-OST-3 sequences were ampliﬁed using 5¢-C...

Ngày tải lên : 18/02/2014, 14:20

14
672
0

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... phosphatase catalytic domains; black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP puriﬁed from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. ... pre- viously characterized PTPr interactor. Nucleolin was ﬁrst described as a major nuclear protein consisting of a negatively charged N-terminal domain, an RNA -binding domain and a...

Ngày tải lên : 19/02/2014, 05:20

14
669
0

Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

... used: 5¢-gaattcagaatg gcctccaagacgta-3¢ and 5¢-gaattcttattcctcctctggccaaa-3¢. The PCR product was cloned, similar to gld1, ﬁrst in a TOPO vector and then in the expression vector p2159. The S. cere- visiae ... by the Maj and Tor Nes- sling Foundation and PR was an Academy Research Fellow of the Academy of Finland. References 1 Baliga BS, Bhatnagar GM & Jagannathan V (196...

Ngày tải lên : 19/02/2014, 06:20

7
510
0