Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... FEBS Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form R. Ndoria Thuku1,2, Brandon W. Weber2, Arvind Varsani2and B. ... speciﬁc post-translational cleavage of recombinantly expressed nitrilase from R. rhodochrous J1 which leads to the for-mation of stable, active helices. 3D reconstruction of the negatively stained ... puriﬁed and active recombinant nitrilase of R. rhodochrous J1. (A) Quaternary polymorphism of the480 kDa oligomer. ‘C’-shaped particles (black arrows) and occasional GroEL contamination (white arrow)...

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for thesubstrate-free PhyK and the substrate-loaded AppAthe averaged distance is only 1.87 A ˚.Distinct conformational changes ... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... polypeptidechain is organized into an a and an a ⁄ b domain, and the active site islocated in a positively charged cleft between the domains. Three sulfateions bound to the catalytic pocket of an inactive...

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAAGTTAGAACT-3¢Reverse: 5¢-TAGCGGCCGCTTACTTTGGGTTAACGACGGA-3¢Mutant MPHbG194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢G198P 5¢-AAAGGTTTCTTCAAGCCGGCCATGGCTTCCCTT-3¢G194P ... Gribenko AV, Patel MM, Liu J, McCallum SA, WangC & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge-charge interactions. Proc Natl Acad Sci USA ... least three replicates. The Kmand kcatval-ues were calculated by nonlinear regression using graphpadprism 5.0 (GraphPad Software Inc., La Jolla, CA, USA).Thermostability assay of WT and...

Tài liệu Báo cáo khoa học: Identiﬁcation of differentially expressed genes of the Paciﬁc oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing ... kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer in B...

Tài liệu Báo cáo khoa học: "Automatic Construction of Polarity-tagged Corpus from HTML Documents" docx

... result.Classifier and data sets As a classifier, wechose Naive Bayes with bag -of- words features,because it is one of the most popular one in thistask. Negation was processed in a similar way asprevious ... works (Pang et al., 2002).To validate the accuracy of the classifier, threedata sets were created from review pages in whichthe review is associated with meta-data. To builddata sets tagged at ... Type A is a table in which the leftmost columnacts as a header, and there are indicators in thatcolumn. Similarly, type B is a table in which thefirst row acts as a header. The table illustrated...

Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf

... reactive non-cleaved glycoform of about 105–120 kDa (Fig. 4A, C,MUC3SEA and MUC12SEA) and a minor population of a CT-2 reactive, M2 nonreactive cleavage product,at about 25 kDa for MUC3 and ... 5¢-GTTCAGGCCAGGAGCTGTGGTGGTACAATTG-3¢ (sense), 5¢-CAATTGTACCACCACAGCTCCTGGCCTGAAC-3¢ (antisense), R ⁄ A substitution:SEA modules and mucin cleavage T. Palmai-Pallag et al.2908 FEBS Journal 272 ... theWTF /A R /A UG /A V /A S /A 5075105160250UWTF /A R /A G /A S /A V /A 2505075105353025WTF /A R /A G /A S /A V /A WTF /A R /A G /A S /A V /A 751053025 A BCDFig. 2. Expression and release of wild-type and cleavage sitemutants of MUC1FDTR...

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... lyase pathway). Bottom: cleavage toyield AMPA and glyoxylate (the AMPApathway), referred to as the GOX pathway.(B) Reaction catalyzed by GO on glyphosate,an alternative to the AMPA pathway ... different from that of GOX.OxidasesGOX (Monsanto)Early on, Monsanto Co. isolated glyphosate-AMPAbacteria from a glyphosate waste stream treatmentfacility. Achromobacter sp. LBAA was thus identiﬁedfor ... glyphosate cannotbe regarded a mere analog of PEP, but it ratherappears to mimic an intermediate state of PEP, pre-sumably that of the elusive carbocation. More than1000 analogs of glyphosate have...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... blotting of lysates from pervanadate-treatedcells with an antibody against total tau revealeddecreased electrophoretic mobility of tau, with theappearance of an  68-kDa tau species in wild-type andall ... Pervandate and catalase wereprepared as described previously [25]. Brieﬂy, vanadatestock solution was prepared as a 200 mM solution of sodium orthovanadate (pH 10). Pervanadate was preparedas ... increasedamount of tau bound to Fyn-SH2, as compared withcells treated with catalase (Fig. 1A) . Furthermore, a tau species of  68 kDa was apparent in SH2 pull-downs from pervanadate-treated...

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccasesJuha P. Kallio1, Chiara Gasparetti2, Martina Andberg2, Harry Boer2, Anu Koivula2, Kristiina Kruus2,Juha ... observed for MaL, that may determinethe properties of these asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession ... copper-containing enzymes used in various applications, suchas textile bleaching. Several crystal structures of laccases from fungi andbacteria are available, but ascomycete types of fungal laccases...

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma-tional rearrangement that exposes the NLS in an extended conformation.DatabaseStructural data are available in ... atoms) and rjis the standard deviation of Bfactors. The normalized B factors have a zero mean and unitvariance. All atoms that satisfy Bz‡ 4 are treated as outliersand discarded. After ... showsthat it adopts the canonical glutathione S-transferasefold with an N-terminal thioredoxin-like domain andan a- helical C-terminal domain [4]. CLIC4 can form poorly selective anion channels that...

Xem thêm