0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... characteristics of protein arginine methyltransferase 1 and 3 towardthe Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, ... (EWS) oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Althoughthe EWS activation domain is a potent transactivation domain that isrequired ... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an ... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing ... GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 ... 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer in B cells, kinasecomplex -associated protein AAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium...
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains theinner ear-specific collagen otolin-1 [9].ResultsCloning ... [9].ResultsCloning of cDNA and DNA encoding OMM-64To obtain cDNA clones encoding proteins contained in the HMW aggregate, immunoscreening was performedusing an antiserum that reacts mainly with the aggregate in ... the protein, to determine the calcium-binding domain of the protein. (A) Schematic drawing of the recombinant proteins. SixGST-fused recombinant proteins containing the three distinctivedomains...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... characterization of a cDNA encod-ing b-amyrin synthase involved in glycyrrhizin andsoyasaponin biosynthesis in licorice. Biol Pharm Bull 24,912–916.16 Hayashi H, Huang P, Inoue K, Hiraoka ... effects of soyasapogenol B derivatives. Bioorg Med Chem Lett7, 85–88.51 Banno N, Akihisa T, Tokuda H, Yasukawa K, Higashi-hara H, Ukiya M, Watanabe K, Kimura Y, HasegawaJ & Nishino H (2004)...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells ... STAT2 DNAbinding domain as revealed by DNA microarrayWe used DNA microarray analysis to compare thegene expression profiles of U 6A (STAT2-deficient),U 6A- 2 (intact STAT2), and U 6A- 2VV-II (mutantSTAT2 ... alpha, beta, or gamma using oligonucleotidearrays. Proc Natl Acad Sci USA 95, 15623–15628.21 Hannigan GE & Williams BR (1992) Interferon-alphaactivates binding of nuclear factors to a sequence...
  • 13
  • 459
  • 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. OVISE cells were plated ... theactivity assay. The main fraction contained a 75 kDamatriptase as a major component and a few contamin-ating proteins as analyzed by SDS ⁄ PAGE.RNAi experiments with OVISE cellsMatriptase ... of protease-activated receptor-2 and single-chainurokinase-type plasminogen activator as substrates.J Biol Chem 275, 26333–26342.34 Ihara S, Miyoshi E, Nakahara S, Sakiyama H, Ihara H,Akinaga A, ...
  • 13
  • 603
  • 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... cerevisiae is underlined.Primer Oligonucleotide sequencesyef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAAATGAAAACTGATAGATTACTGyef1-attB2R AGAAAGCTGGGTGGATTGCAAAATGAGCCTGACattB1 ACAAGTTTGTACAAAAAAGCAGGCTattB2 ... ACAAGTTTGTACAAAAAAGCAGGCTattB2 ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII...
  • 13
  • 560
  • 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... cDNA encoding a truncated protein lacking thetransmembrane and cytosolic domains in- frame with theFLAG peptide) per dish. GeneJuice transfection reagentwas used at a ratio of DNA to reagent of ... provide additional critical infor-mation over that obtained from X-ray data alone. Theknowledge gained from these mutagenesis data will bevaluable in directing the design of modulators of ACE2 activity. ... surface area. Forcomparative purposes, the arginine residue was alsoreplaced with a lysine in order to maintain the chargeon the side chain (R273K). Stable expression of wild-type soluble ACE2 and...
  • 9
  • 789
  • 2
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... morphogenesis, a sixfold elevation in eEF 1A specific activity is accompanied by a dramaticincrease in protein methylation at as many as nine lysineresidues, without any change in the protein or mRNA levels[43]. ... techniqueand a- cyano-4-hydroxycinnamic as matrix, and analysed byusing a Voyager-DE PRO mass spectrometer (AppliedBiosystems, Framingham, MA, USA). Internal-mass calib-ration was performed with ... polyclonal anti-eEF 1A (lane 5), with nuclearproteinsand9lg of total CRS (lane 6), with nuclear proteinsand 0.9 lg of total CRS (lane 7) or with nuclear proteins only (lane 8).The arrow indicates...
  • 12
  • 552
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ