Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACGScCoq7-b CCCCCGGGGCCACTTTCTGGTGSpcoq7 -a GTACAAGCTTGTAAATTTTCGATGGSpcoq7-b CATAGAATTCTTGGTAATCSpcoq7-c AAAGTCGACATGTTGTCACGTAGACAGSpcoq7-w CAAGCAGGTGAATTAGGCSpcoq7-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx
... proteinclaudin-7 correlates with histological grade in bothductal carcinoma in situ and invasive ductal carcinoma of the breast. Oncogene 22, 2021–2033.25 Agarwal R, D’Souza T & Morin PJ ... shown to be in theplasma membrane, including CEACAM5, CEACAM6,VDAC1, VDAC3, isoform 1 of tapasin (TAPBP),SLC2 5A4 , HLA -A1 , CLDN3, ITGB2, Galectin-3 andkeratin type II cytoskeletal 8, and 24% were ... (2005) Claudin-3and claudin-4 expression in ovarian epithelial cellsenhances invasion and is associated with increasedmatrix metalloproteinase-2 activity. Cancer Res 65,7378–7385.26 Katahira J,...
- 11
- 590
- 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc
... protease decreasesthe volume of the S4 pocket while maintaining its apo-lar character. This may explain why all branched-chainaliphatic amino acid residues (Leu, Ile, Val) can befound in the P4 ... substrates was used to assess thespecificity of the A1 69L and K22 0A mutants (Table 2). In general, the mutant enzymes suffered a substantialloss of catalytic power, but they retained a mainly ... them-selves in vivo at a canonical TEV protease-recognition site(ENLYFQflG) to yield TEV protease catalytic domains with N-terminal His tags and C-terminal polyarginine tags [14].Wild-type and mutant...
- 10
- 523
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantianigra pars compacta and appearance of Lewy bodiesconsisting of aggregated protein, mainly a- synuclein, in Keywordsamyloid; fibrillation; Parkinson’s disease;synuclein; thioflavin TCorrespondenceI. ... MPTP andMPP+can facilitate aggregation of a- synuclein in theabsence of any cellular machinery.It has been proposed that the auto-oxidation product of dopamine interacts with protofibrillar a- synucleinand ... dopamine as theneurotransmitter. Thus, reduction of dopamine levels in the striatum is a hallmark of Parkinson’s disease. A variety of pesticides including paraquat, rotenoneand dielderin have...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake IchiseLaboratory of Gene Expression and Regulation, ... endothelial hyaluronan receptor-1 (Lyve-1) expression in liversinusoidal endothelial cells in vivo was retained in vitro, suggesting that anorgan-specific endothelial characteristic was maintained....
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Dimers of light-harvesting complex 2 from Rhodobacter sphaeroides characterized in reconstituted 2D crystals with atomic force microscopy docx
... zig-zag (areas 1 and 2), disordered (area 3) and dimer (area 4) lattices. (B) Zig-zag lattice (area 2), square lattice (area 5) and dimers(area 6). (C) Zig-zag lattice (area 1) and dimers (area ... obtained within one preparation.AFM images allow the differences in protein packingand interaction within the membrane to be visualized.Within the packed lattices, we find a new conforma-tion ... Netherlands2 State Key Lab of Microbial Technology, Shandong University, Jinan, ChinaPhotosynthetic bacteria use a large part of their internalvolume for functionalized invaginations of the intracyto-plasmic...
- 10
- 526
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... 4753Application of a fluorescent cobalamin analoguefor analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factorSergey N. Fedosov1, Charles ... Haber E & Olesen H (1971) Nature of vitaminB12binding. II. Steric orientation of vitamin B12onbinding and number of combining sites of human intrin-sic factor and the transcobalamins. ... BiophysActa 243, 75–82.12 Marchaj A, Jacobsen DW, Savon SR & Brown KL(1995) Kinetics and termodynamics of the interaction of cyanocobalamin (vitamin B12) with haptocorrin:measurement of...
- 12
- 603
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... Miyamoto K, Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloningand sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream ... 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; NP5, 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx
... Gonza´lez Cappa SM, Katzin AM, An˜asco N & Lajma-novich S (1981) Comparative studies on infectivity andsurface carbohydrates of several strains of Trypanosomacruzi. Medicina (B Aires) ... Aires, ArgentinaTrypanosoma cruzi, the etiological agent of Chagas’disease, is a parasitic protozoan with a digenetic lifecycle involving an insect vector and a mammalianhost. The parasite undergoes ... parasites harvested at the early logarithmicphase of growth, and ADC activity values are the average of assays carried out in duplicate. Transformed parasites were cultured in theabsence of...
- 10
- 570
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... Ohno-Iwashita Y, Shimada Y, Waheed AA, HayashiM, Inomata M, Nakamura M, Maruya M & Iwashita S(2004) Perfringolysin O, a cholesterol-binding cytolysin,as a probe for lipid rafts. Anaerobe ... 10, 125–134.19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M,Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno-Iwashita Y (2001) Selective binding of perfringolysin Oderivative to cholesterol-rich ... subpopulation of lipid rafts. Flotillin andLAT, which are abundant in raft fractions, were alsocolocalized with these Src-kinases, accumulating in theBCh-bound membrane fraction. On the other hand,CD3e,...
- 10
- 588
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ