0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an ... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... is a biological component of the lipo-oligosaccharide of a humanpathogen, Moraxella catarrhalis. No other acyltransferases except for UDP-GlcNAc acyltransferase, responsible for lipid A biosynthesis...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA ... protein as a G-quadruplex DNA- and RNA-binding proteinKentaro Takahama1,*, Katsuhito Kino2,*, Shigeki Arai3, Riki Kurokawa3and Takanori Oyoshi11 Department of Chemistry, Faculty of Science, ... Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, Pongor G et al. (2001) Nx-arginine dimethylationmodulates the interaction...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... in B cells, kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ... CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer...
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... 126,511–520.27 Tohse H, Murayama E, Ohira T, Takagi Y & Nagasa-wa H (2006) Localization and diurnal variations of car-bonic anhydrase mRNA expression in the inner ear of the rainbow trout Oncorhynchus ... to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the proteinand that of its DNA are similar to those of starmaker, a protein involvedin...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiaestrain GIL77 Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... Cloning and characterization of a cDNA encod-ing b-amyrin synthase involved in glycyrrhizin andsoyasaponin biosynthesis in licorice. Biol Pharm Bull 24,912–916.16 Hayashi H, Huang P, Inoue ... CYP93E1 for b-amy-rin and sophoradiol suggests that the biosynthesis of soyasaponin might form a metabolic grid, viaFig. 6. GC-MS analysis of in vitro reaction products with b-amyrin as a substrate....
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... in the absence of the STAT2 DNAbinding domain as revealed by real-time PCRTo more quantitatively examine the expression of IFN-regulated genes in the absence of the STAT2 DNAbinding domain, ... on a functional STAT2 DNA bindingdomain do not appear to play an important role in mediating the transcription of these genes. The c-fos gene was examined in this system as anexample of a GAS-driven ... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells...
  • 13
  • 459
  • 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. OVISE cells were plated the day before ... The main fraction contained a 75 kDamatriptase as a major component and a few contamin-ating proteins as analyzed by SDS ⁄ PAGE.RNAi experiments with OVISE cellsMatriptase siRNAs and a scrambled ... RNA as a controlwere designed and synthesized at iGENE (Tsukuba, Japan).The forward sequences of the siRNAs were: #973, sense5¢-UCAUCACACUGAUAACCAACACUGA-AG-3¢;#2578,sense 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and...
  • 13
  • 603
  • 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... cerevisiae is underlined.Primer Oligonucleotide sequencesyef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAAATGAAAACTGATAGATTACTGyef1-attB2R AGAAAGCTGGGTGGATTGCAAAATGAGCCTGACattB1 ACAAGTTTGTACAAAAAAGCAGGCTattB2 ... ACAAGTTTGTACAAAAAAGCAGGCTattB2 ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII...
  • 13
  • 560
  • 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... therefore provide additional critical infor-mation over that obtained from X-ray data alone. Theknowledge gained from these mutagenesis data will bevaluable in directing the design of modulators ... side chain of Arg273 is therefore crit-ical for binding of the substrate. Maintaining the posit-ive charge at this position (R273K) is not sufficient for docking of the peptide into the ACE2 active ... The zinc prote-ase domain of both tACE and ACE2 is divided into two subdomains[20]. Subdomain I contains the zinc ion and the N-terminus. TheC-terminus is found in subdomain II.tACE ACE2Subdomain...
  • 9
  • 789
  • 2
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... auto-radiographed. In the UV cross-linking assay, the samples were incuba-ted at room temperature, as described above for the EMSAassay, and then irradiated at 302 nm for 10 min using a transilluminator ... different isoforms of eEF 1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically bindingto aptameric cytotoxic GT oligomersBarbara Dapas1, Gianluca Tell2, Andrea Scaloni3, ... techniqueand a- cyano-4-hydroxycinnamic as matrix, and analysed byusing a Voyager-DE PRO mass spectrometer (AppliedBiosystems, Framingham, MA, USA). Internal-mass calib-ration was performed with...
  • 12
  • 552
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị10 trần thị luyến và cộng sự hoàn thiện quy trình sản xuất chitin chitosan và chế biến một số sản phẩm công nghiệp từ phế liệu vỏ tôm cua báo cáo khoa học đề tài cấp bộ nha trang 2000nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ