Tài liệu Báo cáo khoa học: Efﬁcient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing Ali Tadlaoui ... participates ingrowth regulation of human breast carcinoma cells. Oncogene 20, 249 9–2 5 13. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M,Nakajima T, Kawashima T, Nanakin A, Sawabu T,Uenoyama Y ... mechanisms of a transcription factor decoy targeting signal transducer and activator of transcription (STAT) 3: the role of STAT1. MolPharmacol 71, 1 435 –1 4 43. 40 Ozaki Y, Edelstein MP &...

Tài liệu Báo cáo khoa học: Efﬁcient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt

... reverse-joined hairpin ribozymesthat are structurally optimized and which, in addition to cleavage, catalyse efficient RNA ligation. The most efficient variant ligated its appropriateRNA substrate with a ... clipping of a fragment of desired length and sequence from a nat-ural RNA may be a useful application. For example,RNA fragments that involve modified nucleobases areeasily obtainable from naturally ... reverse-joined hairpin ribozymes can acton RNA substrates that are not readily accepted by conventional hairpin ribozymes. For example, a hair-pin ribozyme variant with the terminal base pair of theribozyme–substrate...

Tài liệu Báo cáo khoa học: "Efﬁcient Online Locality Sensitive Hashing via Reservoir Counting" ppt

... large-scale distribu-tional semantics (Bhagat and Ravichandran, 2008;Van Durme and Lall, 2009; Pantel et al., 2009; Linet al., 2010; Goyal et al., 2010; Bergsma and VanDurme, 2011), as well as large-scale ... reser-voirs, and a 32 bit integer to track n. This is com-pared to b 32 bit ﬂoating point values, as is standard.Note that our scheme comes away with similar lev-els of accuracy, often at half the ... investigat-ing this tradeoff is a matter of future work.Random Walks As we here only care for the sign of the online sum, rather than an approximation of its actual value, then it is reasonable...

Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx

... ampliﬁed from the pSPORT-AeaAQP by PCR using two primers:AeapS1F, 5¢-GGAAGATCTATGACTGAAAGCGCA -3 ; AeapS1R, 5¢-GGAAGATCTTTAAAAATCGTAAGATTCC -3 . The PCR primers contain BglII restrictionsites ... region of AeaAQP wasampliﬁed from the pSPORT-AeaAQP [22] by thermal cycling usingAeaS1F and AeaS1RprimersandclonedintopXbG-ev1asdescribedin Materials and methods.Fig. 3. AeaAQP functional properties. ... orthogonalarrays were detected by freeze-fracture analysis of AeaAQPoocyte membranes. We conclude that, in tracheolar cells of A. aegypti, AeaAQP is probably a highly water-permeable homotetrameric...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_0011 136 53 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_0011 136 53 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 TGGGGAGGACTTTTATGCTGTRPE6 5a ... TGGGGAGGACTTTTATGCTGTRPE6 5a GSP-Rev CTTTTGTGTAGGTGGGATTCG13cIMH GSP-FwdNM_001089 433 CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_0011 136 53 TTGAGGTGACAGACAATTGCCTRPE65c...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... (2002) MAP kinase signalling cascade in Arabidopsisinnate immunity. Nature 415, 97 7–9 83. 31 Matsui H, Miyao A, Takahashi A & Hirochika H(2010) Pdk1 kinase regulates basal disease resistancethrough ... buffer and [c- 32 P]-ATP. MBP was used as an artiﬁ-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography ... control of nuclear EIN3 by bifurcate MAPK cas-cades in C2H4 signalling. Nature 451, 78 9–7 95. 36 Benjamins R, Ampudia CS, Hooykaas PJ & Offringa R(20 03) PINOID-mediated signaling involves calcium-binding...

Tài liệu Báo cáo khoa học: Puriﬁed RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... cellular retinaldehyde-binding protein. After 2 h of incuba-tion at 37 °C in the dark, the generated retinoids wereextracted with 30 0 lL of methanol and 30 0 lL of hexane and analyzed by normal-phase ... Proc Natl Acad Sci USA 84, 184 9– 18 53. 26 Barry RJ, Canada FJ & Rando RR (1989) Solubiliza-tion and partial puriﬁcation of retinyl ester synthetase and retinoid isomerase from bovine ocular ... afterreassociation with a phospholipid membraneOlga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing MaDepartments of Cell Biology and Medicine Endocrinology, Harold Hamm Oklahoma Diabetes...

Tài liệu Báo cáo khoa học: Pyrimidine-speciﬁc ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

... vector via two engineeredrestriction sites (NdeI and EcoRI) introduced by PCR with the primers 5¢-GCTATTGTGGTAGAATACATATGAGACAC -3 , sense, and 5¢-GGAGTTGTAAAAATTCGAATTCTAAAGAGC -3 , antisense ... N-ribo-hydrolase): functional complementation by a nucleosidehydrolase from a protozoan parasite and by a mamma-lian uridine phosphorylase. Appl Environ Microbiol 68, 133 6– 134 3.18 Ribeiro JM & Valenzuela ... Concilio1, Iolanda Peluso1, Anna Marabotti 3 , Angelo Facchiano 3 and Giovanna Cacciapuoti11 Dipartimento di Biochimica e Bioﬁsica ‘F. Cedrangolo’, Seconda Universita`di Napoli, Italy2 Consorzio...

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... ABCG2R482G. (A) Puriﬁed ABCG2R482G(0.25 lg) was photolabelled with [a 32 P]azido-ATP (3 30 0 lM) as described in Materials and methods.Labelled protein was visualized and quantiﬁed by autoradiography of ... 275 30 0.2 Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M,Pastan I & Gottesman MM (1999) Biochemical, cellu-lar, and pharmacological aspects of the multidrug trans-porter. Annu Rev Pharmacol ... sodium orthovanadate [21]. The metal oxo-anion vanadate serves as a transition state mimic,exploiting its chemical similarity to phosphate. Thus,ATP and vanadate generate an ADP-vanadate struc-ture...

Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

... (underlined) and hadthe sequence 5¢-gacatcaaagcttATGGATAAAGCCATTCAGCATCCT -3 , and the 3 primer had a XhoI restrictionsite (underlined) and the sequence 5¢-aagctcgagTTAGACATTCACAGGAGGGTGGTT -3 . ... primer5¢-TGGGTATGGAGTCCTGTGGT and reverse primer5¢-AGACAGCACTGTGTTGGCATA. In the analysis of Y2 and Y7gene expression, actin was ampliﬁed usingforward primer 5¢-AATCAAGATCATTGCCCCAC and reverse ... Y6receptor has been foundto be nonfunctional as a result of frameshift muta-tions in several mammals, namely human and severalother primates [32 ,34 ,36 ], pig [37 ] and guinea-pig [38 ], and it has been...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien chuyên đề điện xoay chiều theo dạng Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ