0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin Gustav Vaaje-Kolstad, Anne C. Bunæs, Geir Mathiesen and Vincent ... instructions, containingends compatible with the expression vector (forwardprimer, 5¢-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCRproduct ... the start, in the middle and at the end of each series of sam-ples. The resulting average values of the standards (display-ing standard deviations of < 5%) were used forcalibration. All measurements...
  • 14
  • 683
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... immunoprecipitations and can activate tran-scription of the promoter in transient transfectionassays through the upstream part of the SIRF element.Mutational analysis of a putative CDE ⁄ CHR site in the ... usuallylack a TATA-box and employ multiple transcriptionalstart sites [10,14]. Mutation of either a CDE or a CHR in a promoter leads to the activation of tran-scription in quiescent cells. A ... CHR, yielded a further decrease in regulation. The CDE alone was nottested [41]. The CDE mutation that was assayed wouldalso alter a putative CDE site with the standard dis-tance of four nucleotides...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The pro-form of BMP-2 interferes with BMP-2 signalling by competing with BMP-2 for IA receptor binding pptx

Tài liệu Báo cáo khoa học: The pro-form of BMP-2 interferes with BMP-2 signalling by competing with BMP-2 for IA receptor binding pptx

... phosphorylation. The data presented here suggest that the pro-domain of BMP-2 can alter the signalling properties of the growth factorby modulating the ability of the mature part to interact with the ... Ghayor C, Suzuki A, PalmerG & Caverzasio J (2003) Activation of p38 mitogen-activated protein kinase and c-Jun-NH2-terminal kinaseby BMP-2 and their implication in the stimulation of osteoblastic ... ECD was biotinylated and immobilized on streptavidin-coated BIAcore chips.Ligand binding was first analysed using the maturegrowth factor. The fast association rate and the veryslow dissociation...
  • 13
  • 892
  • 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... picolinicacid (PA), quinolinic acid (QA) and NAD homeostasis. Indeed, the enzymestands at a branch point of the tryptophan to NAD pathway, and deter-mines the final fate of the amino acid, i.e. transformation ... insertion domain that comprises a short a- helix and a three-stranded anti-parallel b-sheet; the remaining protein residues form the (a ⁄ b)8barreldomain and a C-terminal extension that comprises ... profile and the associated variation in QA and PA levels [7], and other investigations have clearly demonstrated that changes in ACMSD activity are readily reflectedby serum and tissue QA levels...
  • 9
  • 796
  • 0
Tài liệu Báo cáo khoa học: The intracellular region of the Notch ligand Jagged-1 gains partial structure upon binding to synthetic membranes docx

Tài liệu Báo cáo khoa học: The intracellular region of the Notch ligand Jagged-1 gains partial structure upon binding to synthetic membranes docx

... 5¢-TAATAT TAGCAT ATG GTG ACC GCT TTC TAT TGGGCG CTG CGT AAA CGT CGT AAA CCG GGT AGC-3¢ and 5¢-TAG TAGGGA TCC TCA TTA AAC GATGTA TTC CAT ACG GTT CAG GCT-3¢. The forwardprimer contains a NdeI ... ligands are membrane-spanning proteins made of a large extracellu-lar region, a transmembrane segment, and a  100–200 residue cytoplasmictail. The intracellular region of Jagged-1, one of the ... nucleocytoplas-mic protein. We expressed and purified a recombinant protein starting at the putative intramembrane cleav-age site and comprising part of the transmembranesegment and the entire intracellular...
  • 12
  • 502
  • 0
Tài liệu Báo cáo khoa học: The conformational stability of the Streptomyces coelicolor histidine-phosphocarrier protein Characterization of cold denaturation and urea–protein interactions doc

Tài liệu Báo cáo khoa học: The conformational stability of the Streptomyces coelicolor histidine-phosphocarrier protein Characterization of cold denaturation and urea–protein interactions doc

... literature [8,37]. The errors are calculated from the propagation of fitting errors. DCp¢ was obtained from fitting of the thermal- and urea-denaturation data (using the approach of Pace and Laurents ... calorimet-rically. In both cases, data analyses involves the extra-polation of the thermodynamic parameters to standardconditions, usually 298 K in the absence of denaturant. Toextrapolate thermal denaturation ... in other proteins of the same family, the values of: (a) the change in the heat capacity upon urea-binding; and (b) the change in the enthalpy upon urea-binding are high, probably due to larger...
  • 17
  • 612
  • 0
Tài liệu Báo cáo khoa học: The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site docx

Tài liệu Báo cáo khoa học: The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site docx

... extrusion and uptake of Na+ and K+ionsacross plasma membranes of mammalian cells. The enzymeis a heterodimer of a 100 kDa catalytic subunit and a heavily glycosylated b subunit of about 55 kDa [1–3].Ouabain, ... were usually complementary. The primersequence of the N398D construct was GCTGACACCACAGAGGATCAGAGTGGGGTCTCC and that of the D36 9A construct C CACCATCTGCTCCGCCAAGACTGGAACTCTGAC. The underlined ... more adequately the experimental findings (Figs 5B and 6B): mutation of N398 to aspartate and truncation of the P-domain’s N-terminal part, caused a drop of the phosphatase activity (Fig. 4). The...
  • 14
  • 586
  • 0
Tài liệu Báo cáo khoa học: The social life of ribosomal proteins doc

Tài liệu Báo cáo khoa học: The social life of ribosomal proteins doc

... structure and immediately suggested several important newRNA folds and rationales of RNA tertiary and quater-nary structure that had not hitherto been appreciated[5,7,8]. A wealth of new information ... whether the functional effects of these mutations were due to the architectural and sta-bilizing role of the proteins alone, i.e. that perturba-tion of protein structure would affect the catalyticactivity ... forma-tion, RACK1 is pushed downwards and forms a con-tact to the rear of the mRNA platform of the 40Ssubunit, to the region ascribed to the rpS0 protein. The conformational change and interactions,...
  • 11
  • 563
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The Effect of Corpus Size in Combining Supervised and Unsupervised Training for Disambiguation" pdf

... values of the lattice as a measure of the a nity of attachment phrase and attachmentnode. The intuition is that we are looking for the strongest evidence available for the attach-ment. The strongest ... high attachment (highA), low at-tachment (lowA), verb attachment (verbA), and noun attachment (nounA) according to the gold standard.All instances of RC and PP attachmentswere extracted from ... same set of dependen-cies (a piece of a tile of a roof of a house vs. a piece of a roof of a tile of a house) cannotbe distinguished. We believe that an invertedindex is the most efficient data...
  • 8
  • 515
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The Second Release of the RASP System" pdf

... compiled into an efficientC program encoding a deterministic finite statetransducer. The analyser takes a word form and CLAWS tag and returns a lemma plus any inflec-tional affixes. The type and token ... bootstrapping methods whichutilise an unlabelled bracketing of the SusanneTreebank (Watson et al., 2006). This makes the system more easily retrainable after changes in the grammar and opens up the ... of facilitating cross -system evaluation. The revised GR scheme captures those aspects of predicate-argument structure that the system isable to recover and is the most stable and gram-mar independent...
  • 4
  • 498
  • 0

Xem thêm

Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ