Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
- 9
- 626
- 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... described in Garget al. [13], whereas the data of WhiB3 and WhiB4 were taken from Alam & Agrawal [14] and Alam et al. [15] respectively.Md. S. Alam et al. Molecular properties of M. tuberculosis ... proteins of Mycobacterium tuberculosisH37RvMd. Suhail Alam, Saurabh K. Garg* and Pushpa AgrawalInstitute of Microbial Technology, CSIR, Chandigarh, IndiaMycobacterium tuberculosis has a remarkable ... line) after the baseline correc-tion. The spectra for WhiB3 and WhiB4 are taken from Alam & Agrawal [14] and Alam et al. [15], respectievely.Md. S. Alam et al. Molecular properties of M....
- 18
- 548
- 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. ... R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence verificationPlasmids of the seven mutants were transformed ... E52Q-fwd:5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGGCGC-3¢. E52Q-rev:5¢-GCGCCACTTCTCGACGGGCTGGGTCAGCAGGC-3¢. Y70W-fwd:5¢-CTGCTGGAGCTGATGTGGAAAGATCCCAAGAAG-3¢. Y70W-rev :5¢-CTTCTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢. Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢....
- 10
- 504
- 0
Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt
... weadded a BamHI site upstream from the ATG codon, usingthe 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCTGCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGACTCACTATAGGGCGAATTGGG-3¢). Amplification wasperformed ... The Authors. Journal compilation ª 2005 FEBS 6023Fish and molluscan metallothioneins A structural and functional comparisonLaura Vergani1, Myriam Grattarola1, Cristina Borghi2, Francesco ... Theabsorbance decrease at 254 nm was reported as a fraction of thestandard absorbance (absorbance at room temperature) in order tocompare the denaturation profile of the Cd–thiolate chromophore of the two...
- 10
- 414
- 0
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... plasmin anchorage and subsequent proteolyticactivity. These structural and functional transitionsare determinant in the initiation and acceleration of fibrinolysis and cell detachment and may ... Montes R, Paramo JA, Angles-Cano E & Rocha E(1996) Development and clinical application of a newELISA assay to determine plasmin-alpha2-antiplasmincomplexes in plasma. Br J Haematol 92, ... cells; lane 5, Glu-Pg- and mAb A1 0.2-treated cells; lane 6, Glu-Pg- and mAb 34D3-trea-ted cells. Bands in lanes 1 and 2 correspond to forms I and II of plasmin(ogen). High molecular weight bands...
- 14
- 558
- 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx
... primer, human and mouse L4, senseYH47 ACCGCCGCCTTCTCATCTGA RT-PCR primer, human L4, antisenseYH48 TTCTCTGGAACAACCTTCTCG RT-PCR primer, mouse L4, antisenseYH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern ... interaction in mammalian rRNA production H. Yang et al. Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4Hushan Yang, Dale Henning and Benigno C. ValdezDepartment of ... blot analysis probe, for 18S rRNAYH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNAH. Yang et al. Gua–RPL4 interaction in mammalian rRNA productionFEBS Journal...
- 15
- 433
- 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... Molecular and functional characterization of adenylate kinase 2gene fromLeishmania donovaniHe´ctor Villa1, Yolanda Pe´rez-Pertejo1, Carlos Garcı´ a- Estrada1, Rosa M. Reguera1, ... Jose´Marı´ a Requena2,Babu L. Tekwani3, Rafael Balan˜ a- Fouce1 and David Ordo´n˜ez11Departamento de Farmacologı´ a y Toxicologı´ a (INTOXCAL), Facultad de Veterinaria, Universidad ... including bacteria,fungi and mammals. There are no reports about character-ization of this enzyme in parasitic protozoa. Leishmaniadonovani is the aetiological agent for visceral leishmaniasis, a devastating...
- 9
- 487
- 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... doi:10.1046/j.1432-1033.2002.03108.xSeveral intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), five gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, ... same way asdescribed for the wild-type cDNA.Data base retrievalData base searches and sequence alignments were carriedout with theENTREZ and BLASTsoftware (National Library of Medicine and...
- 9
- 864
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... three sets of primers: first set, A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR products ... xTRHR1 and xTRHR2 subtypes were amplified as described above usingpartially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense...
- 11
- 506
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... level is a key regulator of the rate of mitochondrialrespiration in the heart allowing ATP and creatine phosphate levels tomaintain relatively constant over a large range of cardiac work rateODE ... acetateassimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoAby acetyl-CoA transferaseStoich FBA, opt,MOMA,FVA, SNANG NG Time series of enzymeactivities ... then glycerol, and finally acetateLogic sim NG NG Single time points of fluxes and mRNA measuredby microarraysAsenjo AJ, RamirezP, Rapaport I,Aracena J, Goles E& Andrews BA(2007) J MicrobiolBiotechnol...
- 91
- 733
- 0
Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ