Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

... FEBS C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism Sruti Dutta, Debi Choudhury, Jiban K. Dattagupta and Sampa BiswasCrystallography ... Sundd M,Jagannadham MV & Dattagupta JK (2004) Structuralbasis of the unusual stability and substrate speciﬁcity of ervatamin-C, a plant cysteine protease from Ervata-mia coronaria. Biochemistry ... CT -extension, the possibility19 aa 114 aa208 aa24 aaPre N-Pro Protease domainCT - ex365 aaH1INPro CT ex114 aa208 aa24 aaBamH34 aaStartStopXho1N-Pro Protease domainProtease...

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for thesubstrate-free PhyK and the substrate-loaded AppAthe averaged distance is only 1.87 A ˚.Distinct conformational changes ... groups of HAPs are adapted todifferent habitats. To support plant growth, bacteriado not need to release phosphate as fast as the diges-tive tract of an animal host, where possible substratesmight...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Bxe _A2 876 (accession numbergi:91782944) was ampliﬁed from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... catalyzed breakdown of theb-diketone substrate via oxidative carbon–carbon bondcleavage to yield methylglyoxal and acetate.Kinetic characterization of Fe2+Bxe _A2 876The activity of Bxe _A2 876...

Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

... thechaperone activity of a- crystallin. FEBS Lett 369, 321–325.22 Rao CM, Raman B, Ramakrishna T, Rajaraman K,Ghosh D, Datta S, Trivedi VD & Sukhaswami MB(1998) Structural perturbation of a- crystallin ... interact with a number of functionalgroups, including the aromatic side chains of someamino acids, through a stacking mechanism [42]. Theinteraction of arginine with aromatic amino acids of aB-crystallin ... the pattern of phosphorylation of aAand aB crystallin in the rat lens. Exp Eye Res 71, 385–393.36 Koteiche HA & McHaourab HS (2006) Mechanism of a hereditary cataract phenotype: mutations...

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... lyase pathway). Bottom: cleavage toyield AMPA and glyoxylate (the AMPApathway), referred to as the GOX pathway.(B) Reaction catalyzed by GO on glyphosate,an alternative to the AMPA pathway ... glyphosate cannotbe regarded a mere analog of PEP, but it ratherappears to mimic an intermediate state of PEP, pre-sumably that of the elusive carbocation. More than1000 analogs of glyphosate have ... non-target-sitemechanisms might be the major causes of mostglyphosate-resistant biotypes. In the case of Conyzacanadensis, glyphosate accumulates in vacuoles of resis-tant plants at a markedly...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... Pervandate and catalase wereprepared as described previously [25]. Brieﬂy, vanadatestock solution was prepared as a 200 mM solution of sodium orthovanadate (pH 10). Pervanadate was preparedas ... blotting of lysates from pervanadate-treatedcells with an antibody against total tau revealeddecreased electrophoretic mobility of tau, with theappearance of an  68-kDa tau species in wild-type andall ... increasedamount of tau bound to Fyn-SH2, as compared withcells treated with catalase (Fig. 1A) . Furthermore, a tau species of  68 kDa was apparent in SH2 pull-downs from pervanadate-treated...

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase fromThielavia arenaria – common structural features of asco-laccasesJuha P. Kallio1, Chiara Gasparetti2, Martina Andberg2, Harry Boer2, Anu Koivula2, Kristiina Kruus2,Juha ... observed for MaL, that may determinethe properties of these asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession ... copper-containing enzymes used in various applications, suchas textile bleaching. Several crystal structures of laccases from fungi andbacteria are available, but ascomycete types of fungal laccases...

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma-tional rearrangement that exposes the NLS in an extended conformation.DatabaseStructural data are available in ... reﬂection data ﬁle was then passed through a suite of programs in the ccp4 crystallography package [36].Scaling of intensities and inspection of data quality wereperformed in scala. In particular, ... mean B factor (excluding water moleculesand peptide atoms) and rjis the standard deviation of Bfactors. The normalized B factors have a zero mean and unitvariance. All atoms that satisfy...

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1 10482106611791G4P217 Group 4 ATATGCTGAAACGCGTGAGCATCATGAGACAGAGCGATDENV-3 1043822791G5P30 Group 5 TTCCAACAAGCAGAACAACATGCTACAGGCAGCACGGTTTDENV-4 ... CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1 92.1 ± 0.57 73.6 ± 2.311G4P217 ATATGCTGAAACGCGTGAGCATCATGAGACAGAGCGATDENV-3 90.3 ± 1.09 83.9 ± 5.161G5P30 TTCCAACAAGCAGAACAACATGCTACAGGCAGCACGGTTTDENV-4 81.8 ... CAAACCATGGAAGCTGTACGTTCTGTGCCTGGAATGATGCTDENV-2 98.9 ± 6.23 98.9 ± 6.232G2P5 GAGTGGAGTGGAAGGAGAAGGGCCTCTTGGTGTTGGTCTTTGCDENV-2 98.4 ± 0.84 98.4 ± 0.841G3P6 CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1...

Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

... structure andcatalysis. Biochemistry 48, 3417–3424.31 Nakamura T, Matsumura H, Inoue T, Kai Y, UegakiK, Hagihara Y, Ataka M & Ishikawa K (2005)Crystallization and preliminary X-ray diffractionanalysis ... Nakamura T, Yamamoto T, Abe M, Matsumura H,Hagihara Y, Goto T, Yamaguchi T & Inoue T. (2008)Oxidation of archaeal peroxiredoxin involves a hyperva-lent sulfur intermediate. Proc Natl Acad ... Suzuki5and Yasushi Kawata3,41 National Institute of Advanced Industrial Science and Technology, Ikeda, Osaka, Japan2 Department of Food Science and Nutrition, Faculty of Human Life and Science,...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ